1. Molecular Biology I Some basic concepts

2. Aspects to Cover DNA: structure, replication RNA: transcription and processing Protein: translation Gene Expression: levels of transcription and translation Common Techniques: DNA quantitation Gel electrophoresis Southern/ Northern blot Gene cloning Polymerase chain reaction (PCR) Quantitative Real-time PCR

3. DNA - Molecular Structure Deoxyribonucleic acid (DNA) is the genetic code that exists within every cell. Consists of two associated strands that wind together in a helical fashion. It is often described as a double helix.

4. Each strand is a linear polymer in which the monomers (deoxynucleotides), are linked together by means of phosphodiester bonds. DNA - Molecular Structure A single nucleotide subunit consists of a deoxyribose sugar joined to a phosphate group. Attached to the other side of the sugar molecule is one of four nitrogen bases.

5. Nitrogen Base Pairing PurinesPyrimidines

6. DNA Double Helix 5`end 3`end 5`end

7. DNA – The Genetic Code The genetic code (genotype) determines how an organism looks and functions (phenotype) DNA is essential for all living organisms. The more complex the organism the larger the genome Genotype wild type Phenotype normal Genotype db/db Phenotype obese

8. “Central Dogma” Central dogma describes information flow from DNA→RNA→protein Protein considered the functional unit within the cell

9. DNA Replication

10. Structure of Genomic DNA Gene Promoter Exon 1 23 4 5 Introns Gene: coding and regulatory elements that combine to result in a proteinExons: sequences within the gene that encode the protein structureIntrons: intervening sequences that do not encode the protein structurePromoter: regulatory sequences that, together with transcription factors, determine the amount of gene expression 5`3` Transcription: process to produce RNA from the gene

11. There is more than one type of ribonucleic acid... Messenger RNA (mRNA): carries the genetic information out of the nucleus for protein synthesis. Transfer RNA (tRNA): decodes the information from mRNA. Ribosomal RNA (rRNA): constitutes 50% of a ribosome, which is a molecular assembly involved in protein synthesis. Catalytic/ functional RNAs: involved in reactions in the cell. RNA – From gene to protein

12. RNA is similar to single stranded DNA sense strand Carries the ‘message’ to protein construction centers - ribosomes Uracil (U) replaces thymidine (T) sense strand antisense strand RNA is complementary to DNA antisense strand RNA has same sequence as DNA sense strand RNA synthesis 5` ATGCGTTAGACTTGACACTGACTAC 3` 3` TACGCAATCTGAACTGTGACTGATG 3` DNA 5` AUGCGUUAGACUUGACACUGACUAC 3` mRNA mRNA – The Cellular Messenger Sugar is ribose rather than deoxyribose RNADNA

13. mRNA Processing Pre-mRNA is transcribed from DNA in nucleus by RNA polymerase Protein is translated from the RNA at the cytoplasm at the ribosome Splicing removes introns from pre- mRNA to create mRNA mRNA is transported from the nucleus to the rough endoplasmic reticulum (rER)

14. Protein Translation mRNA arranged in codons – 3 bases tRNA contains specific amino acids for particular anticodons Occurs at ribosomes using mRNA as template and tRNA for assembly of protein building blocks – amino acids Polymerisation of amino acids occurs until a stop codon is read Amino acids polymerise in the order determined by the sequence of mRNA Ribosome shuffles along mRNA to next codon

15. Each amino acid is encoded by one or more codons – degenerate code Decoding the genetic code 20 common amino acids, 1 start codon (Met - AUG), 3 stop codons (UAA, UAG, UGA) RNA to protein: one possible sequence Protein to RNA: many possible sequences

16. “Gene Expression” Gene expression is regulated at both the transcriptional and translational levels – RNA and protein expression don’t always correlate Expression refers to both RNA and protein A single gene does not always produce a single protein

17. Leptin (Ob) Adipocytes Hypothalamus Ob-R NPY -ve Leptin Background -ve

18. Ob-RL Ob-RS Alternate splicing of Ob-R Ob-RL and Ob-RS are identical in mRNA up until exon 18 Ob-RL uses exon 18a & 18b and Ob-RS uses exon 18 a Different stop codon result in different proteins

19. Transmembrane Extracellular Intracellular Ob-RLOb-RS Leptin Receptor – Ob-R GT

20. Summary DNA replicates itself at every cell division, placing a copy of itself in every cell in every organism Transcription produces a copy of the DNA called RNA Translation decodes the information from the gene/mRNA into a protein – the functional endpoint of gene expression Transcription and translation are independently regulated – mRNA and protein levels are not necessarily correlated Small changes at the DNA level can produce drastic changes at the protein level

21. DNA/RNA Quantitation DNA/RNA can be extracted from virtually any tissue using special chemicals and purification procedures Once extracted, DNA/RNA can be dissolved in water and used for a variety of different techniques – PCR etc Wavelength (nm) Absorbance 1.60 0 200350 260 280 Spectrophotometer can analyse the spectral properties of the nucleic acid A 260 /A 280 = 1.8 A 260 = 1.0  50  g/ml A 260 /A 280 = 2.0 A 260 = 1.0  40  g/ml Similarly for RNA

22. Gel Electrophoresis DNA can originate from a variety of sources: genomic DNA - from organisms plasmid DNA - circular, cloned fragments amplified DNA - specific fragments from PCR Knowing the size of the DNA is beneficial in identifying the fragments – distance migrated is inversely proportional to the size of the molecule DNA size is usually measured in numbers of base pairs: bp (1 – 1000) kb (thousands of bp) Mb (millions of bp)

23. Gel Electrophoresis DNA size approximated by electrophoresis through agarose and comparison with fragments of known size - + Load DNA onto gel Apply electric current to gel (100 V) Negatively charged DNA migrates to positive electrode DNA moves according to size – small fragments more faster than large fragments 100 bp 200 bp 300 bp 400 bp 500 bp 1 kb ~400 bp ~250 bp Due to phosphate backbone DNA has negative charge

24. Standard methodology resolves relatively small DNA molecules (0.1-50kb) Ethidium bromide used to stain DNA – binds and fluoresces under UV illumination % agarose determines range of DNA sizes resolved 0.3% w/v resolves DNA of 5-50 kb 2.0% w/v resolves DNA of 0.1-2 kb Gel Electrophoresis