1. Molecular Biology Background

3. Schematic view of DNA organization in a cell

4. A Gene is the fundamental physical and functional unit of heredity. A gene is an ordered sequence of nucleotides located in a particular position on a particular chromosome that encodes a specific functional product (i.e., a protein or RNA molecule). A Genome is all the genetic material (DNA) in the chromosomes of a particular organism; its size is generally given as its total number of base pairs. Genes and Genomes

6. genetics.gsk.com/ graphics/dna-big.gif Four nucleotides: adenine (A), cytosine (C), guanine (G), and thymine (T) Bindings: –A with T (weaker), C with G (stronger) Forms a double helix – each strand is linked via sugar-phosphate bonds (strong), strands are linked via hydrogen bonds (weak) Genome is the part of DNA that encodes proteins: –…AACTCGCATCGAACTCTAAGTC… DNA Structure

7. Comparisons between DNA and single stranded RNA with the diagram of the bases showing.

8. The chemical structure of DNA

9. Why is genomics interesting for the signal processing person? Because there are sequences there! OK, what sort of sequences? 1. Sequences from an alphabet of size four: … ATTCGAAGATTTCAACGGGAAAA … DNA 2. Sequences from an alphabet of size twenty: AACWYDEFGHIKLMNPQRSTVAPPQR Protein

10. Size-4 alphabet: A, C, T, G: bases (also called or nucleotides) DNA sequences (genomes) are made of these. Genes are parts of DNA, and are 4-letter sequences. Adenine Thymine Cytosine Guanine or Uracil (in RNA) DNA: deoxyribonucleic acid RNA:ribonucleic acid

15. Central Dogma of Molecular Biology Flow of information in a cell Recent development of high-throughput technologies that study the above flow – requires interdisciplinary effort – dealing with a huge amount of information

16. Details of the information flow Replication of DNA –{A,C,G,T} to {A, C, G,T} Transcription of DNA to mRNA –{A,C,G,T} to {A, C, G,U} Translation of mRNA to proteins –{A,C,G,U} to {20 amino- acids} http://www-stat.stanford.edu/~susan/courses/s166/central.gif

18. Genes can be turned on and off

20. The twenty natural amino acids (B,J,O,U,X,Z missing) 11 essential amino acids. Animals cannot make the eleven indicated amino acids. They need to eat them; Milk provides all of these. Grains and beans together provide all of these.

21. Protein Example Fibroblast growth factor proteins Basic bovine Acidic bovine length 146 length 140

22. Example of a Protein: Hemoglobin (oxy, human) http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm Sequence of amino acids. Folds into beautiful 3D shapes. Necessary for function.

23. Example of a protein (an enzyme) http://www.biochem.szote.u-szeged.hu/astrojan/protein2.htm

26. The mapping from amino acids to codons is many-to-one

30. Computational Gene-Finding