1. The Cell

2. Cell membrane components Mostly proteins: –on the surface  receptor –Below the surface  mostly enzymes –Across  allows compounds to move in and out of the cell (channels or pumps)

3. Factors affecting transport: cell membrane The cell needs to absorb and excrete various compounds throughout its life. These compounds need to pass through the membrane which is made from a phospholipid bilayer The phospholipid bilayer is formed by phospholipid molecules  bipolar molecule: the fatty acid side is hydrophobic, the phosphoric side is hydrophilic

4. The membrane is permeable to: -H2O -Gases (O2, CO2, N2) -Lipids -Small, neutral molecules (such as urea) The membrane is impermeable to: - Small, charged molecules -“large molecules” such as amino acids, glucose and larger  these compounds must go through channels present in the membrane in order to enter or exit the cell

5. Factors affecting transport: Chemical gradient Compound moves from an area of high concentration to low concentration (or concentration gradient) All compounds permeable to the phospholipid bilayer will move this way

6. Passive transport Compounds will move from area of high concentration toward area of lower concentration No ATP is needed for this type of transport

7. Diffusion Compounds move toward the area of lower concentration Compounds permeable to the cell membrane will move through diffusion. (Compounds unable to pass through the membrane will only pass if membrane channels open)

8. Osmosis Each compound obeys the law of diffusion However, some compounds are unable to cross the cell membrane (glucose, electrolytes…) Water can cross  will enter or exit the cell depending its concentration gradient Note: the cell membrane is a semipermeable membrane

9. Solution tonicity Isotonic solution: solution which has the same compound concentration as the cell Hypotonic solution: solution having a compound in lower concentration compared to the cell Hypertonic solution: solution having a compound in higher concentration compared to the cell

10. Facilitated diffusion Some compounds are unable to diffuse through the membrane. They will be allow to cross if the membrane has proteins that can bind these compounds and enable to cross toward the area of lower concentration

11. Figure 4.11a

12. Active transport Compounds move from area of low concentration toward area of higher concentration ATP (energy) is needed  pump

13. ATPase pumps The most common: Na/K pumps  reestablish membrane potential. Present in all cells. Two K + ions are exchanged with 3 Na + ions

14. Phagocytosis

15. Figure 4.21c Receptor-mediated endocytosis Cell receptors bind to a compound  initiate endocytosis

16. Nucleus Contains the chromosomes – 46 in human Chromosomes are made of DNA wrapped around proteins (the histones)

18. Cytoplasm – Ribosomes - Golgi apparatus Cytoplasm = cytosol (water + nutrients + salts) + endoplasmic reticulum (membrane) Endoplasmic reticulum: can have ribosomes attached to it (rough) or nothing (smooth) Ribosomes = special structures in charge of synthesizing proteins Golgi apparatus = special area of the ER where proteins are processed

19. Mitochondria Lysozomes Make ATP (the fuel) for the cell Contains digestive enzymes

20. Cell skeleton Tubules Filaments Important for cell shape and cell movement

21. Cell functions Multiplication  for growth, differentiation and gamete formation Protein synthesis –Transcription – DNA  RNA –Translation – RNA proteins

22. Interphase: phase between mitosis During interphase, the cell grows, functions  G1 If the cell decides to undergo division (mitosis), it will replicate its DNA first  S phase Then, it will prepare for mitosis  G2 (during G2 the cell synthesizes the proteins needed for mitosis When everything is ready, then the cell undergo mitosis.

23. Cell multiplication You can watch a few movies on mitosis (no need to remember the names of the various phases) Just remember that the daughter cells are identical http://www.youtube.com/ watch?v=VlN7K1-9QB0http://www.youtube.com/ watch?v=VlN7K1-9QB0 http://www.youtube.com/ watch?v=CzPGhYiGyZ8http://www.youtube.com/ watch?v=CzPGhYiGyZ8 http://www.youtube.com/ watch?v=Ru8zC_JRyTIhttp://www.youtube.com/ watch?v=Ru8zC_JRyTI

24. Protein synthesis: 2 steps Step 1: a copy of the gene (located in the nucleus DNA) is made. This copy is a single strand of mRNA = transcription Step 2: mRNA then, travels to the cytoplasm where it will be read by the ribosomes. The ribosomes will use the code to assemble the various amino acids http://www.youtube.co m/watch?v=41_Ne5m S2lshttp://www.youtube.co m/watch?v=41_Ne5m S2ls

25. Step 2: Translation The ribosomes use the genetic code in order to know what amino acid to plug in the sequence The code is the sequence of 3 nucleotides (=codon) on the mRNA http://www.youtube.co m/watch?v=1NkLqjQk GHUhttp://www.youtube.co m/watch?v=1NkLqjQk GHU

27. Lets practice Part of the template strand on the DNA is: ATGGCCGTATTGCATCCGAGCTGAATT What will be the mRNA strand produced during transcription?

28. Lets practice Part of the template strand on the DNA is: ATGGCCGTATTGCATCCGAGCTGAATT WHICH STRAND IS THE CORRECT STRAND? TACCGGCATAACGTAGGCTCGACTTAA Or UACCGGCAUAACGUAGGCUCGACUUAA

29. This strand travels toward the cytoplasm where ribosomes will translate it. UACCGGCAUAACGUAGGCUCGACUUAA The process is rather complex. We just want to understand the principle: The ribosome will see the first codon UAA and will look for the matching “anticodon-amino acid”. The genetic code will show which one it is.

31. UAC-CGG-CAU-AAC-GUA-GGC-UCG-ACU- UAA Next codon is CGG  Arginine Next CAU  Histidine AAC  ? GUA  ? GGC  ? UCG  ? ACU  ? UAA  ?

32. So, why is this important? Sometimes, mistakes happen. If the code is wrong, then the amino acid placed in the protein chain is the wrong one  different shape  different function  most frequently loss of function  Mutation! Cause of cancer, many genetic diseases