1. Using Biology to Solve a Crime Who killed Mrs. Brogan?? Disclaimer: Mrs. Brogan is actually alive and well, this scenario is intended for educational purposes only.

2. Case Background Mrs. Brogan was found dead in the prep room. Mrs. Brogan was found dead in the prep room. Stab wound to the chest. Stab wound to the chest. Blood stains found on the cabinet (Blood #1) and on the floor (Blood #2). Blood stains found on the cabinet (Blood #1) and on the floor (Blood #2). Manalapan police suspect this class. Manalapan police suspect this class. Blood samples were sent to the AP biology class for analysis. Blood samples were sent to the AP biology class for analysis.

3. Goal Determine whose blood was left on the wall and on the cabinet. Determine whose blood was left on the wall and on the cabinet. Use DNA fingerprinting to help solve the crime! Use DNA fingerprinting to help solve the crime!

4. Step 1: Polymerase Chain Reaction Used to increase the amount of DNA collected at a scene. Used to increase the amount of DNA collected at a scene. Millions of copies in a few hours

5. Step 2: Restriction Enzymes Cut isolated DNA at specific locations to create bands of differing lengths. Cut isolated DNA at specific locations to create bands of differing lengths. TATTAACGCAACGCGCTCAGGCCAAACTTGTAT Cuts after ‘AAC’ TATTAACGCAACGCGCTCAGGCCAAACTTGTAT

6. Step 3: Electrophoresis Uses electrical charge to separate DNA fragments by size Uses electrical charge to separate DNA fragments by size DNA is negatively charged, runs toward pos. DNA is negatively charged, runs toward pos. Gel is a matrix Gel is a matrix Smaller fragments travel further Smaller fragments travel further Dying the gel allows us to see the different bands of DNA Dying the gel allows us to see the different bands of DNA

8. Fragments Size TATTAAC = 7bp GCAAC = 5bp GCGCTCAGGCCAAAC = 15bp 20 15 10 5 TATTAACGCAACGCGCTCAGGCCAAACTTGTAT Run DNA on a gel

9. Activity 1 Draw lines on your DNA strand to represent where the restriction enzyme would cut (after ‘AAC’). 2 Count how many bases are in each new segment. 3 Draw lines on the ‘gel’ to demonstrate what the banding pattern would look like.

10. Which suspect’s blood was on the scene? 15 10 5 Brogan Blood #1 Blood #2 Suspect A Suspect B 15,10,9,813,11,7,5

11. Conclusions Can we be 100% certain that Suspect B killed Mrs. Brogan?? Can we be 100% certain that Suspect B killed Mrs. Brogan?? Why or why not? Why or why not? Other applications Other applications Paternity testing Paternity testing HIV conformation (western blot) HIV conformation (western blot) Determining evolutionary relationships Determining evolutionary relationships