1. Protein Synthesis $100 $200 $300 $400 $500 $100$100$100 $200 $300 $400 $500 Central Dogma Basics Transcription RNA Mutations FINAL ROUND Translation

2. Central Dogma Basics : $100 Question This is the place where transcription takes place in eukaryotic cells BACK TO GAME ANSWER

3. Central Dogma Basics : $100 Answer BACK TO GAME Nucleus

4. Central Dogma Basics : $200 Question BACK TO GAME ANSWER These are the parts of mRNA that do not code for protein

5. Central Dogma Basics: $200 Answer BACK TO GAME introns

6. Central Dogma Basics : $300 Question BACK TO GAME ANSWER This is the site where translation takes place

7. Central Dogma Basics : $300 Answer BACK TO GAME Ribosomes (in cytoplasm or on Rough ER)

8. Central Dogma Basics: $400 Question BACK TO GAME ANSWER This is a sequence of DNA that codes for protein(s)

9. Central Dogma Basics : $400 Answer BACK TO GAME Gene

10. Central Dogma Basics : $500 Question BACK TO GAME ANSWER This is the central dogma

11. Central Dogma Basics : $500 Answer BACK TO GAME DNA  RNA  Protein

12. Transcription: $100 Question BACK TO GAME ANSWER This is the enzyme that synthesizes mRNA

13. Transcription : $100 Answer BACK TO GAME RNA polymerase

14. Transcription : $200 Question BACK TO GAME ANSWER This is the region of DNA where RNA polymerase binds

15. Transcription : $200 Answer BACK TO GAME Promotor

16. Transcription : $300 Question BACK TO GAME ANSWER This is the portion of DNA that signals transcription to stop

17. Transcription: $300 Answer BACK TO GAME Terminator

18. Transcription : $400 Question BACK TO GAME ANSWER This is the process takes place after transcription in which mRNA is edited

19. Transcription : $400 Answer BACK TO GAME mRNA splicing

20. Transcription : $500 Question How does mRNA exit the nucleus BACK TO GAME ANSWER

21. Transcription : $500 Answer BACK TO GAME Through nuclear pores

22. Translation: $100 Question BACK TO GAME ANSWER This is the start codon

23. Translation : $100 Answer BACK TO GAME AUG

24. Translation : $200 Question BACK TO GAME ANSWER This is the site on the ribosomes in which polypeptide chain grows

25. Translation : $200 Answer BACK TO GAME P site

26. Translation : $300 Question BACK TO GAME ANSWER These are the type of bonds that exist between amino acids

27. Translation : $300 Answer BACK TO GAME peptide bonds

28. Translation : $400 Question BACK TO GAME ANSWER This is the site on the ribosome in which the next tRNA enters the ribosome

29. Translation : $400 Answer BACK TO GAME A site

30. Translation: 500 BACK TO GAME ANSWER Describe initiation of translation

31. Translation : 500 BACK TO GAME mRNA finds a ribosome and binds to it; the start codon (AUG) codes for a tRNA carrying the amino acid methionine; this tRNA enters the ribosome at the P site and translation begins

32. RNA: $100 Question BACK TO GAME ANSWER This type of RNA contains codons

33. RNA: $100 Answer BACK TO GAME mRNA

34. RNA: $200 Question BACK TO GAME ANSWER This type of RNA contains anti-codons

35. Translation : $200 Answer BACK TO GAME tRNA

36. RNA : $300 Question BACK TO GAME ANSWER This type of RNA carries amino acids

37. RNA : $300 Answer BACK TO GAME tRNA

38. RNA : $400 Question BACK TO GAME ANSWER RNA is different from DNA because…..

39. RNA : $400 Answer BACK TO GAME Ribose sugar; Uracil instead of Thymine; single stranded

40. RNA : $500 Question BACK TO GAME ANSWER These are the types of RNA involved in translation

41. RNA: $500 Answer BACK TO GAME mRNA, tRNA, rRNA

42. Mutations: $100 Question BACK TO GAME ANSWER This type of mutation codes for the same amino acid therefore there is no effect on the protein

43. Mutation: $100 Answer BACK TO GAME Silent mutation

44. Mutation : $200 Question BACK TO GAME ANSWER This type of mutation involves a substitution of a nucleotide that results in a stop codon reached to soon therefore the polypeptide chain is not complete and the protein is nonfunctional

45. Mutation : $200 Answer BACK TO GAME Nonsense mutation

46. Mutation : $300 Question BACK TO GAME ANSWER Insertion or deletion of a nucleotide will result in this type of mutation

47. Mutation : $300 Answer BACK TO GAME Frameshift

48. Mutation: $400 Question BACK TO GAME ANSWER This type of mutation is a substitution which results in a different amino acid

49. Mutation : $400 Answer BACK TO GAME Missense mutation

50. Mutation : $500 Question BACK TO GAME ANSWER Why can one difference in amino acid sequence be harmful?

51. Mutation : $500 Answer BACK TO GAME The protein shape can be altered by just one change in amino acid; if the shape is incorrect the function of the protein is incorrect

52. FINAL ROUND Question BACK TO GAME ANSWER Transcribe and Translate the following gene…. 5’ TTTCAGCTACAAAGAGTAGATT 3’

53. FINAL ROUND Question BACK TO GAME ANSWER DNA= 5’TTTCAGCTACAAAGAGTAGATT 3’ mRNA=3’AAAGUCAUGUUUCUCAUCUAA 5’ Amino acids = (start)met- phe- leu- iso- stop