1. DNA:
History and Structure

2. A Brief History of DNA (deoxyribonucleic acid):
Discovery of DNA by many different scientists
1928 – Griffith – studied how bacteria made people sick; found that a gene could change harmless bacteria into disease-causing ones
1944 – scientists led by Avery – DNA is a nucleic acid that stores and transmits the genetic information from one generation of an organism to the next
1952 – Hershey & Chase – studied viruses that killed bacteria; viruses have DNA too

3. Structure of DNA Three important jobs of DNA:
Carry information from one generation to the next
Put information to work by determining the heritable characteristics of organisms
Has to be easily copied

4. Structure of DNA (continued)
DNA is a long molecule (polymer) made up of units called nucleotides (monomers) and has two strands/sides
Each nucleotide is made up of three basic parts
A 5-carbon sugar (deoxyribose)
A phosphate
A nitrogenous (nitrogen-containing) base
4 bases found in DNA
Adenine and Guanine (both purines)
Cytosine and Thymine (both pyrimidines)
Backbone of DNA formed by sugar and phosphate groups
Four nucleotides can be strung together in many different ways to carry coded genetic information

5. DNA Nucleotides Purines Pyrimidines Phosphate group Deoxyribose
Adenine
Guanine
Cytosine
Thymine
Phosphate group
Deoxyribose

6. Double Helix
1953 – Watson & Crick – built a 3D model of DNA that was a double helix, in which two strands were wound around each other
Hydrogen bonds form between certain bases to help form the helix

7. Structure of DNA Nucleotide Hydrogen bonds Sugar-phosphate backbone
Key
Adenine (A)
Thymine (T)
Cytosine (C)
Guanine (G)

8. Chargoff’s Rule – “Base-Pairing”
Adenine (A) can ONLY bond with one Thymine (T)
Cytosine (C) can ONLY bond with one Guanine (G)

9. A = T G = C “Base-Pairing” Tool
Here’s an excellent tool to help you remember which nucleotides bond together and why:
A = T
G = C

10. Using the Base-Pairing Rule
Because of the structure of DNA, the Base-Pairing Rule, and the “tool” from the previous slide, if given ONE side of DNA, you can give the “other side.”
Ex: What is the “other side,” or complimentary strand, to this strand of DNA:
GGGGTTCGAAATTTCGCGAAT
CCCCAAGCTTTAAAGCGCTTA