1. GENETICS

2. Trait An observable characteristic of an organism Eye color Freckles
Tongue rolling
Hair color
Dimples
Widow’s peak
Right or left handed
Height

3. 6. Phenotype
The expression of a specific trait.

4. 7. Allele
A version of a gene. Different alleles have a different orders of DNA bases (letters).
ATGTATGGCTATTAGGCTAT
Two different alleles of the gene for eye color
ATGTGCGGCTATTAGGCTAT

5. 8. Dominant
An allele that masks the recessive allele in a hybrid

6. 9. Recessive
An allele that is masked by the dominant allele in a hybrid

7. 10. Genotype
The specific alleles of a gene in an organism.

8. 11. Heterozygous
An organism with two different alleles of a gene

9. 12. Homozygous
An organism with two alleles that are the same

10. Are all traits inherited?

11. Are all traits inherited?
NO! Some traits are inherited (in your DNA),
others are acquired (from your environment).
Genetics deals with inherited traits.