Download presentation
Presentation is loading. Please wait.
1
From DNA to Proteins
2
Remember…Characteristics of Living Things
made up of units called cells reproduce based on a universal genetic code (DNA) grow and develop obtain and use materials and energy (metabolism) respond to their environment (adapt) maintain a stable internal environment (homeostasis) taken as a group, organisms evolve
3
DNA Function Structure stores genetic information to make proteins
double sided chain of nucleotides that form a double helix
4
Parts of a DNA Nucleotide
Sugar: deoxyribose Phosphate group Nitrogen base Adenine (A) Guanine (G) Cytosine (C) Thymine (T)
5
The Nitrogenous Bases Purine: double ring Adenine Guanine Pyrimidine:
one ring Thymine Cytosine
6
Watson and crick DNA is a double helix/spiral staircase or two nucleotide chains wrapped around each other in spiral. Shape discovered by James Watson and Francis Crick; young scientists at Cambridge University Backbone is alternating sugars and phosphates. Nitrogen bases attach the two strands in the center.
7
Number of A = T Number of G = C Chargaff’s Observations Adenine (A) & Thymine (T) bind Guanine (G) & Cytosine (C) bind Double ring (A, G) to a single ring (T, C) The bases are connected to each other in the double helix by weak hydrogen bonds. Therefore, it was determined…
8
Complementary base pairs
Pairing Between Bases A purine on one strand is always paired with a pyrimidine on the opposite strand Complementary base pairs The sequence of bases on one strand of DNA determines the sequence of bases on the other strand TCGAACT AGCTTGA
9
DNA Organization DNA is very long. The nucleus of each human cell contains more than 1 meter of DNA. So how does it all fit? DNA is wrapped around proteins to make chromatin which is tightly wrapped and coiled into chromosomes. REMEMBER: DNA makes up genes and genes make up chromosomes.
10
DNA replication Watson & Crick: “It has not escaped our notice that the specific pairing we have postulated immediately suggests a possible copying mechanism for the genetic material”
11
DNA REPLICATION Process of copying DNA
Cells use enzymes to unwind the DNA and copy it using complementary base pairing rules. Makes EXACT copies of DNA.
12
DNA Replication DNA has 2 complementary strands that follow base pairing rules (A-T and C-G). DNA strands separate or unzip. a) DNA helicases: enzymes that open the double helix by breaking hydrogen bonds between the two strands b) Replication forks: the areas of the double helix separates Step 1 Original strands serve as templates. Enzyme (DNA polymerase) binds new nucleotides to the template strands following base pairing rules. Step 2 Result is 2 exact copies of DNA, each having one original strand and one new strand. Step 3
13
Copying DNA Build daughter DNA strand
use original parent strand as “template” synthesis enzyme = DNA polymerase add new matching bases DNA Polymerase
14
Replication = fast & accurate
In humans, 50 nucleotides/second are added to a DNA strand There are hundreds of origins of replication…replicating DNA takes just a few hours! Proofreading: DNA POLYMERASE Errors sometimes occur! The wrong nucleotide may be added to a new strand Can only add nucleotides to the growing strand if the previous nucleotide was correctly paired Can backtrack and remove the incorrect nucleotide Reduces errors in DNA to 1/1 billion nucleotides Video Wrap-Up
15
Rna carries DNA’s instructions
16
Protein Synthesis: Part 1
So… How does the cell get the instructions from the nucleus to the ribosomes? CELL CYTOPLASM NUCLEUS RIBOSOMES – where proteins are made DNA – stores info to make proteins mRNA Where are the instructions to make proteins? Where are proteins made? It makes a copy to send called – messenger RNA
17
Protein synthesis Proteins are made on the ribosomes in the cytoplasm.
DNA (instructions to make proteins) must stay in the nucleus. How does the cell get the directions from the nucleus to the ribosomes? IT MAKES A COPY! Messenger RNA (mRNA) is a disposable copy of DNA that can leave the nucleus.
18
Decoding Information in DNA
Traits, such as eye color, are determined by proteins that are built according to instructions coded in DNA Proteins are not built directly from DNA RNA (ribonucleic acid) is involved
19
DNA: Deoxyribonucleic Acid
RNA: Ribonucleic Acid Structure: Single Strand of Nucleotides Sugar Ribose Nitrogenous Bases Adenine (A) Guanine (G) Cytosine (C) Uracil (U) DNA: Deoxyribonucleic Acid Double Strand of Nucleotides Sugar Deoxyribose Thymine (T)
20
three types of RNA Messenger RNA (mRNA) Transfer RNA (tRNA)
carries DNA code out of nucleus / “disposable copy” Transfer RNA (tRNA) build proteins following instructions from mRNA Ribosomal RNA (rRNA) makes up ribosomes
21
Transcription REMEMBER: DNA cannot leave the nucleus so mRNA is used as a copy of DNA that can leave the nucleus. Transcription the process which makes mRNA by copying part of the DNA Cells use enzymes to unwind the DNA and make mRNA using the complementary base pairing rules. (Happens much like DNA replication.)
22
Transcription Steps A – T C – G G – C A – T C – G T – A
DNA has 2 complementary strands that follow base pairing rules (A-T and C-G). 1. DNA strands separate or unzip 2. One of the original strands serves as a template. Enzyme (RNA polymerase) binds new RNA nucleotides to the template strand following base pairing rules. (A-U, C-G) 3. mRNA leaves the nucleus and carries the instructions to the ribosomes. The DNA “re-zips” A – T C – G G – C A – T C – G T – A A T C G G C A T C G T A A - U T C - G G G - C C A - U T C - G G T - A A A – T U C – G G G – C C A – T U C – G G T – A A 1 2 3 Transcription Animation
23
Protein synthesis: part 2
mRNA carries the instructions for making proteins which are made of amino acids. BUT …. RNA language – A, U, C, G Protein language – 20 different amino acids (examples: arginine, valine, serine, etc.) How would you follow directions that were written in a different language? TRANSLATION
24
translation Process of assembling proteins (chains of amino acids) from the information in mRNA mRNA has to be translated into a protein’s amino acid sequence. Occurs on the ribosomes and uses all 3 types of RNA tRNA has an amino acid attached at one end and 3 nucleotides at the other end called an anti-codon. mRNA is read in groups of 3 nucleotides called codons.
25
Special codons Start: AUG: codes for the amino acid methionine – helps a ribosome bind on and starts the translation Stop: UAA, UAG, UGA: tells the ribosome to stop translating and release the finished protein
26
mRNA to protein = Translation
mRNA instructions ribosome instruction reader tRNA builders ribosome mRNA Protein Complete!
27
TRANSLATION STEPS 5. Process continues until the ribosome reads a stop codon, at which time it releases the finished amino acid chain (AKA: protein) 4. Another tRNA with the complementary anti-codon binds to the mRNA codon. The amino acid from the tRNA binds to methionine. 3. Ribosome shifts down the mRNA to the next codon. 2. tRNA with the complementary anti-codon (UAC) binds to the mRNA codon bringing the amino acid methionine with it. 1. Ribosome attaches to the mRNA at the start codon (AUG)
30
Recap of Protein Synthesis
mRNA is made in the nucleus using DNA as a template. (TRANSCRIPTION) mRNA leaves nucleus and travels to ribosomes. Proteins are made by tRNA at the ribosomes using mRNA as instructions. (TRANSLATION)
31
The Genetic Code Chart shows which amino acid that each mRNA codon represents. Read by starting at the center and working outwards.
32
The mRNA code For ALL life! Code is redundant Start codon Stop codons
strongest support for a common origin for all life Code is redundant several codons for each amino acid mutation insurance! Strong evidence for a single origin in evolutionary theory. Start codon AUG methionine Stop codons UGA, UAA, UAG
33
Transcription & Translation Practice
DNA: G T T A C A C G C A G T A C T C A A U G U G C G U C A U G A glut – cyst – alan – serin – stop transcription RNA: translation Protein:
34
SO… How will gene mutations affect the mRNA that is copied from the DNA? How will gene mutations affect the protein coded for by the mRNA? How will gene mutations affect the organism that contains these proteins?
35
Gene Mutations Gene mutations: changes in a single gene
Point Mutation: substitution of a single nucleotide Example: Correct DNA: TAC CAT ATG TGG CAT Substitution: TAC CAT ATC TGG CAT Effect: Only one codon is affected so only one amino acid in the protein is affected.
36
Only one amino acid affected
37
Point mutation leads to Sickle cell anemia
What kind of mutation?
38
Frameshift mutations Deletion Insertion THERATANDTHECATATETHEREDBAT
THERTANDTHECATATETHEREDBAT THERTANDTHECATATETHEREDBAT Insertion THERAATANDTHECATATETHEREDBAT THERAATANDTHECATATETHEREDBAT
39
2. Frameshift Mutation: deletion or insertion of nucleotides Example:
Normal DNA : TAC CAT ATG TGG CAT Insertion: TAC CAT AAT GTG GCA T Deletion: TAC CAA TGT GGC AT Effect: Reading frame is shifted so all of the codons from that point on are different making all of the amino acids in the protein different too.
40
All or most amino acids affected
Insertion Cysteine Arginine All or most amino acids affected
41
All or most amino acids affected
Deletion Stop Leucine Arginine All or most amino acids affected
42
Cystic fibrosis Primarily whites of European descent
strikes 1 in 2500 births 1 in 25 whites is a carrier (Aa) normal allele codes for a membrane protein that moves Cl- across cell membrane mutant channel limit movement of Cl- (& H2O) across cell membrane thicker & stickier mucus coats cells mucus build-up in the pancreas, lungs, digestive tract & causes bacterial infections without treatment children die before 5; with treatment can live past their late 20s Cystic fibrosis is an inherited disease that is relatively common in the U.S. Cystic fibrosis affects multiple parts of the body including the pancreas, the sweat glands, and the lungs. When someone has cystic fibrosis, they often have lots of lung problems. The cause of their lung problems is directly related to basic problems with diffusion and osmosis in the large airways of the lungs. People without cystic fibrosis have a small layer of salt water in the large airways of their lungs. This layer of salt water is under the mucus layer which lines the airways. The mucus layer in the airways helps to clear dust and other inhaled particles from the lungs.
44
Identifying Mutations
Normal DNA: ATACGATGCTAGCGATCG Mutated DNA: ATAGGATGCTAGCGATCG Point Mutation: G substituted for C Mutated DNA: ATACGATTGCTAGCGATCG Frameshift Mutation: Insertion of T Mutated DNA: ATACGTGCTAGCGATCG Frameshift Mutation: Deletion of A
45
From gene to protein protein DNA mRNA trait tRNA transcription
aa transcription translation DNA mRNA protein ribosome tRNA aa U C A G trait nucleus cytoplasm
46
DNA transcription mRNA Can you tell the story? ribosome tRNA
amino acids mRNA Can you tell the story? protein ribosome tRNA translation
47
Gene Expression = protein synthesis
DNA TACGCACATTTACGTACGCGG mRNA AUGCGUGUAAAUGCAUGCGCC aa protein trait
48
Remember…Characteristics of Living Things
made up of units called cells reproduce based on a universal genetic code (DNA) grow and develop obtain and use materials and energy (metabolism) respond to their environment (adapt) maintain a stable internal environment (homeostasis) taken as a group, organisms evolve
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.