Central Dogma.

Similar presentations


Presentation on theme: "Central Dogma."— Presentation transcript:

1 Central Dogma

2 Introns and exons The DNA is first transcribed into pre-mRNA (which includes both introns and exons) Introns – non-coding regions of a gene (junk DNA) Exons – part of a gene that codes for amino acids Mature mRNA has had the introns removed, leaving only the ______. exons

3 Translation process of converting information in nucleic acid sequences into proteins

4 Information stored in the _______ is transferred out of the nucleus using ______ and taken to the _________ where proteins are made. AAUGGCUGUAUU Every 3 bases is called a codon (think code) How many codons are shown above? DNA mRNA Ribosome 4

5 Gene - a sequence of bases that codes for a specific protein.
20 different amino acids

6 2nd letter of codon stop stop stop 3rd letter of codon 1st letter of codon

7 Stop codons = UAA, UGA, UAG
Start codon = AUG Translation always starts at this codon Stop codons = UAA, UGA, UAG Translation stops when ribosome comes across stop codon A protein is a string of amino acids connected

8 Translate the mRNA sequence below: AAGAUGUUUGCGCUGCGAUAGCCC
Don’t forget your start and stop codons!

9

10 Translation animation:


Download ppt "Central Dogma."

Similar presentations


Ads by Google