1. Central Dogma

2. Introns and exons
The DNA is first transcribed into pre-mRNA (which includes both introns and exons)
Introns – non-coding regions of a gene (junk DNA)
Exons – part of a gene that codes for amino acids
Mature mRNA has had the introns removed, leaving only the ______.
exons

3. Translation
process of converting information in nucleic acid sequences into proteins

4. Information stored in the _______ is transferred out of the nucleus using ______ and taken to the _________ where proteins are made.
AAUGGCUGUAUU
Every 3 bases is called a codon (think code)
How many codons are shown above?
DNA
mRNA
Ribosome 4

5. Gene - a sequence of bases that codes for a specific protein.
20 different amino acids

6. 2nd letter of codon
stop
stop
stop
3rd letter of codon
1st letter of codon

7. Stop codons = UAA, UGA, UAG
Start codon = AUG
Translation always starts at this codon
Stop codons = UAA, UGA, UAG
Translation stops when ribosome comes across stop codon
A protein is a string of amino acids connected

8. Translate the mRNA sequence below: AAGAUGUUUGCGCUGCGAUAGCCC
Don’t forget your start and stop codons!

10. Translation animation: