Presentation is loading. Please wait.

Presentation is loading. Please wait.

Use of SNP-DNA analysis in authenticating Basmati rice

Similar presentations


Presentation on theme: "Use of SNP-DNA analysis in authenticating Basmati rice"— Presentation transcript:

1 Use of SNP-DNA analysis in authenticating Basmati rice
From waaay back in …with a font that was fashionable then

2 Single nucleotide polymorphisms
Single nucleotide differences exist between individuals, plant and animal varieties and bacterial strains TCGAAATGCATGCGCATGATT Variety 1 TCGAAATGCATGCGCGTGATT Variety 2

3 Assaying SNPs by MALDI-ToF MS
Once a SNP is identified, 3 primers are required to enable genotyping including:- - Two PCR primers to amplify the region around the SNP 5’ ’ - One Extension primer which anneals directly adjacent to the SNP. 5’ ’

4 Assaying SNPs by MALDI-ToF MS
TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT Anneal primer TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TTACGTACGCG +polymerase +ddNTP’s TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TTACGTACGCGT TTACGTACGCGC Analyse extension products by MALDI-TOF MS

5 MALDI-TOF Mass Spectrometry
Electric potential across the flight tube to the detector. Larger ions take longer to fly. This Time of Flight (ToF) allows the separation of ions on the basis of size. Samples spotted onto a MALDI plate Nitrogen laser (337nm) vaporises and ionises the sample.

6 Difference in peak size reveals the SNP allele for that rice variety
Assaying SNPs by MALDI-ToF MS C = 273 Da T = 288 Da A = 297 Da G = 313 Da Difference in peak size reveals the SNP allele for that rice variety Unextended SNP primer Extended SNP primer

7 Multiplexing SNP assays

8 Quantitative SNP assays

9 MALDI-TOF-based DNA authentication of basmati rice
Sponsored by the FSA

10 FSA sponsored work includes:-
Completing a SNP database for the main commercial varieties and their adulterants. Assessing the reproducibility of the protocols to determine the uncertainty of the method. Performing a limited survey of Basmati Products being sold in UK supermarkets. Developing a Standard Operating Procedure

11 Basmati rice varieties
Traditional breeds Basmati 386 Basmati 370 Dehradun Ranbir Basmati Taraori (HBC-19) Hybrid Basmati 385 Super Basmati Pusa Basmati Kasturi Basmati 198 Common Adulterants Pusa 169 Sabarmati PR 106 Kali-much Lakra Saket 4 Parimal Sherbati Terricot

12 Assembling a SNP database for Basmati varieties and adulterants

13 Examples of survey work

14 SNP Genotyping using primer I
Primer + C Primer + T Tilda basmati Rice ASDA basmati rice

15 SNP Genotyping using 11 primers
Tilda basmati rice behaves like traditional variety Kernal Asda basmati rice suggests another hybrid: Pusa

16 SNP analysis as a QC tool
Plausible contamination / mixture (S + T = 2003) ?

17 from mixing (or crossing)
SNP analysis as a QC tool New SNP marker alleles Revealed that the 2003 crop could NOT have arisen from mixing (or crossing) Super Basmati (S) with Thai (T) rice

18 HumanOmniExpress-24 BeadChip
Number of Markers >713,014 HumanOmniExpress-24 BeadChip Zoom ahead to 2012 Manhattan plot of association with cilantro soapy-taste from 14,604 unrelated participants


Download ppt "Use of SNP-DNA analysis in authenticating Basmati rice"

Similar presentations


Ads by Google