Presentation is loading. Please wait.

Presentation is loading. Please wait.

Modern genetics.

Similar presentations


Presentation on theme: "Modern genetics."— Presentation transcript:

1 Modern genetics

2 Modern genetics DNA is responsible for inherited traits
DNA also controls the cell’s functions DNA is involved in both replication and protein synthesis.

3 DNA Replication

4 Steps of DNA replication
1. DNA uncoils 2. Free nucleotides attach to appropriate base pairing 3. Two new DNA strands are made 4. Recoiling of two new exact copies of DNA

5 Uncoiling and recoiling

6 Two new identical dna strands

7 Remember base pairs

8 Protein synthesis DNA in the nucleus contains the code to control the cell’s functions. DNA directs the construction of proteins in the __________.

9 Protein synthesis Involves mRNA and tRNA

10 mRNA Messenger RNA Single stranded Contains bases A-U and G-C
Small size

11 mRNA mRNA enters and leaves nucleus easily mRNA copies DNA (almost)
This step is called transcription. DNA is said to be transcribed

12 Transcription DNA Code is passed to mRNA

13 Translation In this step mRNA goes to the ribosome
The mRNA carries a codon (3 bases) into the ribosome Within the ribosome the mRNA meets up with tRNA

14 Picture of tRNA

15 tRNA Carries specific amino acids into ribosome from cytoplasm
Has an anti-codon to translate the mRNA code

16 Translation of mRNA

17 Construction of a protein

18 Base codes for amino acids

19

20 Protein synthesis

21 GENE MUTATIONS Any change in the base sequence of an organism’s DNA
Deletion: missing a piece Addition: contains a repeated piece Translocation: contains a piece from another chromosome Inversion: order is reversed Substitution: incorrect base is inserted

22 GENETIC ENGINEERING Scientists can change genes. This is called genetic engineering. Ex. Tobacco plant and firefly Types of Genetic Engineering: Cloning Recombination

23 CLONING Cloning Producing genetically identical cells
One parent cell can be cloned to produce an entire organism Ex. Skin grafting, Dolly

24 DOLLY & BONNY

25 DOLLY

26 RECOMBINANT DNA Transferring genes from one organism to another.

27 RECOMBINANT DNA- HUMAN GROWTH HORMONE (HGH)

28 RECOMBINANT DNA Why? Can be used to produce insulin for diabetic patients. Can be used to make human growth hormones in a lab.

29 HUMAN GENOME PROJECT taattctcccctctgcttgtttcccccttaaaatatttaacccccggggcccccttatagcagatacattacgattagcatta taattctcccctctgcttgaaatttcccccttaaaatatttaacccccggggcccccttatagcagatacattacgattagcatta taattctcccctctgcttgtttccccggcttaaaatatttaacccccggggcccccttatagcagatacattacgattagcatta Taattctcccctctgcttgtttcccccttaaaatattcgcgtaacccccggggcccccttatagcagatacattacgattagcattandsoon…

30 HUMAN GENOME PROJECT Map of human gene locations.


Download ppt "Modern genetics."

Similar presentations


Ads by Google