1. What is Transcription? Transcription is the process of creating
a complementary RNA copy of a sequence of DNA. During transcription, a DNA sequence is read by RNA polymerase, which produces a complementary, antiparallel RNA strand. As opposed to DNA replication, transcription results in an RNA complement that includes uracil (U) in all instances where thymine (T) would have occurred in a DNA complement.

2. The Importance of Transcription
Transcription is the first step leading to gene
expression. The stretch of DNA transcribed into an
RNA molecule is called a transcription unit and
encodes at least one gene. If the gene transcribed
encodes a protein, the result of transcription is
messenger RNA (mRNA), which will then be used
to create that protein via the process of translation.
Alternatively, the transcribed gene may encode for
either ribosomal RNA (rRNA) or transfer RNA (tRNA), other
components of the protein-assembly process, or other
ribosome.

3. Translation process and outcome
In translation, messenger RNA (mRNA) produced by
transcription is decoded by the ribosome to produce a
specific amino acid chain, or polypeptide, that will later fold
into an active protein. In Bacteria, translation occurs in the
cell's cytoplasm. In Eukaryotes, translation occurs across
the membrane of the endoplasmic reticulum. The ribosome
facilitates decoding by inducing the binding of tRNAs with
complementary anticodon sequences to that of the mRNA.
The tRNAs carry specific amino acids that are chained
together into a polypeptide as the mRNA passes through
and is "read" by the ribosome.

4. Translation Illustration

5. The Role of DNA and RNA during Transcription Process
In DNA replication, DNA is read from 3' → 5' during transcription. Meanwhile, the complementary RNA is created from the 5' → 3' direction. This means its 5' end is created first in base pairing. Although DNA is arranged as two antiparallel strands in a double helix, only one of the two DNA strands, called the template strand, is used for transcription. This is because RNA is only single-stranded, as opposed to double-stranded DNA. The other DNA strand is called the coding strand, because its sequence is the same as the newly created RNA transcript (except for the substitution of uracil for thymine).

6. Transcription process
1) Helicase unwinds/"unzips" the DNA by breaking the hydrogen
bonds between complementary nucleotides.
GGCCGCTTGACAAAAGTGTTAAATTG
coding DNA
CCGGCGAACTGTTTTCACAATTTAAC
DNA template

7. Transcription Process
RNA nucleotides are paired with complementary DNA bases from the 5’ to the 3’ end when the RNA Polymerase-Promoter Complex binds to the promoter gene in the DNA.
RNA
5’ GGCCGCUUGACAAAAGUGUUAAA
3’ CCGGCGAA CTGTTTTCACAATTT 5’
Complementary DNA

8. Transcription Process
sugar-phosphate backbone forms with assistance from RNA polymerase.

9. Transcription Process
If the cell has a nucleus, the RNA is further processed (addition of a 3' poly-A tail and a 5' cap) and exits through to the cytoplasm through the nuclear pore complex.

10. Transcription Process
Hydrogen bonds of the untwisted RNA+DNA helix break, freeing the newly synthesized RNA strand.
Newly synthesized RNA strand
5’ GGCCGCUUGACAAAAGUGUUAAA

11. Transcription Steps Review
1) Pre-initiation-RNA polymerase binds to core promoters on DNA in the presence of various specific transcription factors.
2) Initiation-The completed assembly of transcription factors and RNA polymerase bind to the promoter, forming a transcription initiation complex.
3) Promoter clearance-After the first bond is synthesized, the RNA polymerase must clear the promoter. During this time there is a tendency to release the RNA transcript and produce truncated transcripts.
4) Elongation-RNA polymerase traverses the DNA template strand from 3' → 5', and uses base pairing complementarity with the DNA template to create an RNA copy. This produces an RNA molecule from 5' → 3', an exact copy of the coding strand DNA (except that thymines are replaced with uracils, and the nucleotides are composed of a ribose (5-carbon) sugar where DNA has deoxyribose (one less oxygen atom) in its sugar-phosphate backbone).
5) Termination-in eukaryotes termination of transcription involves cleavage of the new transcript followed by template-independent addition.

12. Illistration of Transcription Steps
Initiation
Elongation
Termination

13. QUIZ
Transcription is
A process creating a complimentary DNA strand from a RNA template strand.
A process creating a complimentary RNA strand from a DNA template strand.
A process creating a complimentary RNA strand from a RNA template strand.
A process creating a complimentary DNA strand from a DNA template strand.

14. QUIZ 2) The result of transcription is
Gene expression leads to desired protein synthesis.
Protein synthesis leads to gene expression.
Formation of mRNA, tRNA and rRNA.
Only a & c

15. QUIZ 3) Translation occurs During the process of transcription.
Before the process of transcription.
After the process of transcription.
Before and after the process of transcription.

16. QUIZ 4) Protein is made up of subunits of Nucleic acids Amino acids
Fatty acids
Nuclear base pairs

17. QUIZ 5) During transcription, the RNA strand is always read from
3’ to 5’ direction
5’ to 3’ direction
Either direction
Anywhere on the DNA strand.

18. QUIZ 6) In Eukaryote, the process of the transcription occurs in
The nucleus
The cytoplasm
The endoplasmic Reticulum
The ribosome

19. QUIZ 7) The five steps of transcription are in the order of
Pre initiation, Initiation, elongation, promoter clearance, termination
Pre initiation, Initiation, promoter clearance, elongation, termination.
Pre initiation, Initiation, elongation, promoter clearance, termination.
Pre initiation, Initiation, elongation, termination, promoter clearance.

20. QUIZ
8) During elongation process of transcription, the Base Thymine is replaced with
Adenine
Cytosine
Uracil
Guanine

21. QUIZ 9) The difference(s) between DNA and RNA is(are) One of the base
Form of sugar
Single versus double strands
All of the above

22. QUIZ 10) Translation in Eukaryote takes place in The nucleus
The cytoplasm
The Endoplasmic Reticulum
The ribosome

23. Challenge Question Why is transcription process so important?
If a mistake happens during the transcription
process, what will happen?

24. QUIZ Answer – Transcription
1) b
2) b
3) c
4) b
5) b
6) c
7) b
8) c
9) d
10) d

25. Answer to Challenge Question
Transcription is so important because the
genetic coding needs to be transcribed
correctly to produce the necessary proteins
that the body needs. If a mistake happens
during transcription, non functional proteins
might be produced and leads to deficiency in
the body functions.