1. The Nucleic Acid Family Nucleic acids are important as genetic molecules (DNA and RNA), as energy molecules (ATP and NAD), & as messenger molecules (cAMP) in cell metabolism Basic building block of all nucleotides is called a nucleotide Nucleotides are composite molecules made of a 5-carbon sugar, a nitrogen-filled base, and a phosphate P-O

2. Deoxyribonucleic Acid DNA is a long helical polymer – actually a double-helix monomer is called a nucleotide Four kinds of nucleotides in DNA: adenine, thymine, guanine and cytosine (most often represented as A, T, G, and C ) NOTE: these names actually refer only to the names of the four nitrogenous bases attached to each nucleotide.

3. Adenine Nucleotide (deoxyadenosine 5'-phosphate) Thymine Nucleotide (deoxythymidine 5'-phosphate) Cytosine Nucleotide (deoxycytidine 5'-phosphate) Guanine Nucleotide (deoxyguanosine 5'-phosphate) PURINESPYRIMIDINES

4. The Base Pairing Rule This is the key to the genetic code A purine base will H-bond to a pyrimidine base according to the following rules: In DNA: A to T and C to G A forms only 2 H-bonds with T C forms 3 H-bonds with G (A cannot H-bond to G, nor can C form H-bond with T)

5. DNA Basepairs (bps)

6. DNA DNA structural formula

7. A More Simplified View of DNA

8. Levels of DNA Structure as with proteins, DNA has several levels of structure Primary Structure = base sequence (typical DNA is millions of bps in length; since two sides are complementary, then only one side (reading strand) needs to be written when stating primary structure of a DNA molecule – for example... ACCTTAGGCATCCGAGGCTAAGGTTCCCATTACT GGACCGAGGTTACCGACCTTTACCGCAGACAGA AGCCAGCTACCTTGGACCGAGGTTACCGACCTT TGGACCGAGGTTACCGACCTTTGGACCGAGGTT ACCGACCTTTGGACCGAGGTTACCGACCTTGG

9. Tertiary Structure: the overall 3-D shape of the DNA molecule shows two grooves along its length – a major groove and a minor groove; B-DNA and A-DNA differ in the sizes of these two grooves; Secondary Structure: the helical twist pattern of the DNA may be right-handed or left-handed; Right-handed DNA is called B-DNA; left-handed DNA is called Z-DNA;

10. RNA – Ribonucleic Acid This molecule is similar to DNA except... a) it is single-stranded & linear, not double-stranded helical b) ribose sugar instead of deoxyribose c) uracil base instead of thymine (i.e. G, C, A and U – in base pairing rule A-U and C-G) mRNA is used as a mobile copy of a gene for protein synthesis Messenger RNA (mRNA)

11. yet another form of RNA used in protein synthesis; is partly double-helical and partly single-stranded; one end attaches to an amino acid; just as there are 20 different amino acids, there are 20 different tRNA – one for each amino acid tRNA transfers amino acids to ribosomes – the protein factories of the cell; Transfer RNA (tRNA)

12. Ribosomal RNA (rRNA) used to make ribosomes – rRNA + protein; the largest molecule (other than DNA) in the cell; It is the assembly point for amino acids, tRNA, mRNA and various enzymes – all involved in the process of protein synthesis 3 Types of RNA: mRNA, tRNA, rRNA Summary

13. ATP – Adenosine Triphosphate uses adenine nucleotide with the ribose sugar; has 2 extra phosphates added to the one already there; These two extra phosphates are attached by very weak covalent bonds – paradoxically called high- energy bonds; When a phosphate is removed from ATP, lot of energy is released for use by cell;

14. NAD – Nicotinamide Adenine Dinucleotide Composed of two nucleotides, thus called a Dinucleotide; Both nucleotides joined by their phosphate groups – using a 5‘-5‘ bond unlike in DNA and RNA; Both nucleotides use ribose sugar; One uses adenine base and the other a base called nicotinamide; FAD (flavin adenine dinucleotide) is a related molecule with riboflavin instead of nicotinamide;