1. Nucleic Acids Include DNA and RNA Function to carry coded information The code controls the sequence of amino acids in a polypeptide i.e. the primary structure of a protein.

2. Nucleic acids The information must be passed on to all new cells in cell division. The information must be passed on to all new organisms in reproduction(information is inherited).

3. Chromosome

4. Chromosomes are made of: Deoxyribonucleic Acid (DNA) Histones (proteins)

5. DNA was discovered by Watson and Crick in 1953 DNA contains genes Gene A length of DNA that carries the code for synthesis of a polypeptide. Intron – a section of DNA which does not code for a polypeptide (not a gene)

6. Two forms of nucleic acid Polymers made up of nucleotides Deoxyribonucleic Acid (DNA) (double strand) Ribonucleic Acid (RNA) (single strand)

7. Nucleotide Five carbon sugar Phosphate group Organic Base

8. Pentose sugar In DNA this sugar is DEOXYRIBOSE In RNA this sugar is RIBOSE

9. Phosphate group The same in DNA and RNA Makes the molecule NEGATIVELY charged P -P -

10. Organic Base Two groups Both contain CARBON and NITROGEN 1. PYRIMIDINE Single ring Cytosine Thymine Uracil

11. 2. PURINE Double ring Adenine Guanine

12. A NUCLEOTIDE P -

13. DNA the bases are Adenine Guanine Cytosine Thymine RNA the bases are Adenine Guanine Cytosine Uracil So URACIL replaces THYMINE in RNA What are the differences so far between DNA and RNA?

14. Formation of DNA DNA is made up of two polynucleotide chains. The bases hold this molecule together by HYDROGEN BONDS Cytosine + Guanine (C-G) 3 H Bonds Adenine + Thymine (A-T) 2 H Bonds

15. The molecule twists to form the DOUBLE HELIX

16. BASE PAIRING RULE If one half of DNA has a base sequence of: T A C C T G A T G T C A A G What is the base sequence of the other half?

17. DNA DeoxyriboNucleic Acid Double stranded helix Monomers are: Nucleotides 4 different Nitrogenous Bases are: Cytosine Guanine Adenine Thymine C G A T

18. RNA Ribonucleic acid Single stranded Monomers are: Nucleotides 4 Nitrogenous Bases Cytosine Guanine Adenine Uracil C G A U

19. Messenger RNA (mRNA) Adenine Guanine Uracil Cytosine

20. Transfer RNA (tRNA) Amino acid attachment 3 bases forming the anticodon

21. overview of protein synthesis - transcription and translation

22. DNA and RNA How are the structures of DNA and RNA similar and different?

23. Genetic code Order of bases in an organisms DNA This code determines the sequence of amino acids in a polypeptide

24. Triplet code 3 bases code for one amino acid

25. How many amino acids are coded for in this gene: AATCGACCGTTAGCATTGCCAAGCTAC 9

26. Transcription (DNA to mRNA) At the region to be copied DNA Helicase breaks the hydrogen bonds between DNA bases exposing unpaired bases RNA polymerase moves along the template strand (sense strand) of DNA joining complementary RNA nucleotides to the exposed bases. RNA polymerase joins the ribose – phosphate backbone of the RNA nucleotides one at a time to build a strand of pre-mRNA The DNA rejoins behind it

27. Splicing The non coding INTRONS are removed from the pre-mRNA The mRNA molecules diffuse out of the nuclear pores and attaches to a ribosome. The process of Translation can now take place

28. Quick quiz Give 3 differences between DNA and RNA A mRNA has the following code: AUGCCCAAUUUGGGCCUAUGA 1.What are the anticodons on the tRNA? 2.Which amino acids are coded for? 3.Which protein has been made? Met Pro Asn Leu Gly Leu Stop

29. Translation http://www-class.unl.edu/biochem/gp2/m_biology/animation/gene/gene_a3.html http://highered.mcgraw-hill.com/olc/dl/120077/micro06.swf

30. Translation Ribosome attaches to the start codon (AUG) on the mRNA The tRNA with the complementary anticodon (UAC) pairs with the codon on the mRNA A second tRNA with the next complementary anticodon pairs with the next codon on the mRNA

31. Translation cont. The ribosome moves along the mRNA The amino acids on the first two tRNA attached together by a peptide bond The first tRNA leaves the ribosome to pick up another amino acid This process continues until a stop codon is reached