Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.

Slides:

Advertisements

Similar presentations

Advertisements

KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.

Mutations Hollywood’s images of mutation. Mutations Hollywood’s images of mutation.

Mutations From Gene to Protein Honors Biology Ms. Kim.

Gene Mutations. Target #17- I can describe a gene mutation Gene mutation: a permanent heritable change in the sequence of bases in DNA – Effect can cause.

Chapter 8 Section 8.7: Mutations.

Human Genetic Mutations

8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.

CHAPTER 13 GENE REGULATION 1. 2 Mutation Mutation is a permanent change in the sequence of bases in DNA. Protein is completely inactivated Germ-line mutations.

Mutations Genetic Changes.

Don’t let this happen to you!!. MUTATIONS Changes in DNA that affect genetic information.

Mutations In molecular biology and genetics, mutations are changes in the DNA sequence of a cell's genome. ntent/variation/

Agenda Songs? Go over transcription/translation jokes simulation

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

Genetic Mutations. Mutations Mistakes made in the DNA sequencing They can have a range of effects. They can affect the genetic information that is passed.

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

8.7 Mutations TEKS 6E The student is expected to: 6E identify and illustrate changes in DNA and evaluate the significance of these changes.

1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.

GENE REGULATION Gene regulation: The ability of an organism to control which genes are transcribed in response to the environment.

LS: I will be able identify and describe the different types of mutations.

Mutations. What comes to mind???? Mutants.

MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.

Mutation: The Source of Genetic Variation Chapter 11.

GENETIC MUTATIONS What is this picture depicting?.

Because Stuff Happens. A. Mutation Overview  Any change or random error in the nucleotide sequence (either DNA or mRNA) is called a mutation  Can occur.

Unit 6 Notes: Mutations. DNA Mutations Mutations: Any change in the sequence of nitrogenous bases of DNA. Causes: – Mutagens = factors that change chemical.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)

MUTATIONS No this can’t happen with just mutations.

Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

Molecular Genetics Mutations  A permanent change that occurs in a cell’s DNA is called a mutation.  Types of mutations  Point mutation  Insertion.

Genetic Mutation. Mutation Greatest source of genetic diversity A change in the sequence of nucleotides of a gene. Some changes to the DNA will alter.

MUTATIONS Mutations Defined: a change in an organism’s DNA. Many kinds of mutations can occur, especially during replication. 2 Types: 1)Gene Mutations:

Mutations and Nature vs. Nurture.

Gene Mutations.

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Mutations Bio Explain how mutations in DNA that result from interactions with the environment (i.e. radiation and chemicals) or new combinations.

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Chapter 17 Mutations (PART 5)

Mutations Ms MacCormack Fall 2018.

Bellwork How do we account for the wide variety of organisms that are on the Earth?

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

DNA: The Blueprints For Life

Protein Synthesis and Mutation

Mutations: Changes in Genes

Presentation transcript:

Genes and Gene Mutations

Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases within a gene. Mutations can be beneficial – May enable an organism to handle stress in the environment. Can lead to malfunctioning proteins in cells.

Mutations may occur in… Gametes – May be passed to offspring Somatic cells – Not passed to offspring – May result in cancer

Three Causes of Mutations Errors in replication – Rare – DNA polymerase “proofreads” the new strand against the old strand – Usually, mismatched pairs are replaced with the correct nucleotide.

Three Causes of Mutations Mutagens – Environmental influences – Radiation (radioactive elements, X rays, UV light), chemicals (cigarettes, pesticides) – Rate is low because DNA repair enzymes monitor and repair irregularities. – Ex. Cancer

Three Causes of Mutations Transposons – Specific DNA sequences that move within and between chromosomes. – “Jumping genes” – Movement to a new location can alter neighbouring genes by increasing or decreasing their expression. – Ex. Hemophilia: the ability of blood to clot is reduced. The protein to clot blood isn’t made properly.

Types of Mutations Frameshift mutations – One or more nucleotides are inserted or deleted – The polypeptide codes for the wrong sequence of amino acids. THE FAT CAT ATE THE RAT THE FAT HCA TAT ETH ERA T H THE FAT CAT ATE THE RAT TEF ATC ATA TET HER AT H Ex. Tay-Sachs Disease. Several deletions and insertions lead to an early stop codon.

Types of Mutations Point Mutations – One nucleotide is substituted for another. THE FAT CAT ATE THE RAT THE FAT HAT ATE THE RAT

Types of Mutations Point Mutations Silent Mutation: There is no change if the new codon codes for the same amino acid. Ex. if GAA is changed to GAG. Both code for glutamate.

Types of Mutations Point Mutations Nonsense Mutation: Codon codes for a stop. Ex. Cystic fibrosis

Types of Mutations Point Mutations Missense Mutation: Codon codes for the wrong amino acid. Affects the shape of the protein. Ex. Sickle-Cell Anemia. Valine is added instead of glutamate.