The expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbits Taehyung Lim, MD 1,2,4, Hyuk- Jin Choi.

Slides:

Advertisements

Similar presentations

Evaluation of Human-Derived Feeder Layers for Ex Vivo Cultivation of Corneal and Oral Epithelium for Ocular Surface Reconstruction No financial conflict.

Advertisements

Epi LASEK: creating epithelial flaps using variable alcohol concentrations and variable duration of exposure Pravin K Vaddavalli, Subramaniam SV, Sangwan.

Severe Phenotypes of Granular Corneal Dystrophy Type 2 and Genetic Analysis Results Yong Woo Ji, MD, Eung Kweon Kim, MD, PhD, Seung-Il Choi, PhD, Bong-Yoon.

Antibiotic Susceptibilities in Patients With Contact Lens Associated Microbial Keratitis Jimmy Lim 1, Muhammad A. Ismail 2 Eileen Sim 2, Timothy Barkham.

EVALUATION OF INTRA-CORNEAL INJECTION OF 5% NATAMYCIN FOR THE TREATMENT OF FUSARIUM KERATITIS Fani Segev MD, Guy Tam MD, Yossi Paitan PhD, Dvora Kidron.

Biosynthetic Collagen Substitute Proves Useful to Stabilize Corneal Wounds in Combat: A Rabbit Model Karin E. Thomas, MD and Joseph F. Pasternak, MD Walter.

Bilateral Corneal Trophic Ulcers and Subsequent Infectious Keratitis in a Patient with Graft-versus-host Disease Yonca Aydın Akova, MD Bayındır Hospital,

Young Joo Shin 1, Joo Hyun Kim 1, Jung Ha Kim 2, Woo Ho Nam 1, Kayoung Yi 1, Joon Young Hyon 3, 1 Department of Ophthalmology, Hallym University College.

Copyright restrictions may apply Sensitivity and Specificity of a Point-of-Care Matrix Metalloproteinase 9 Immunoassay for Diagnosing Inflammation Related.

Association between Depression And Dry eye Sang Beom Han, MD, 1 Joon Young Hyon, MD, 1 Young Joo Shin, MD, 1 Won Ryang Wee, MD, 2 Jin Hak Lee, MD, 1 1.

So-Hyang Chung, MD, PhD, Choun-Ki Joo, MD, PhD Department of Ophthalmology and Visual Science, College of Medicine, The Catholic University of Korea, Seoul,

The authors have no financial interest in the subject matter of this poster. The Effect of Topical Epigallocatechin Gallate (EGCG) Treatment on Murine.

New Antiinflammatory Strategy to Treat Murine Dry-Eye Disease

Copyright restrictions may apply JAMA Ophthalmology Journal Club Slides: Effects of Azithromycin in Patients With Meibomian Gland Disease Zhang L, Su Z,

Effects of IOP Lowering Agents on Myopic Regression after Refractive Surgery Lim, Taehyung M.D., Hong, So Jin M.D., Cho, Beom Jin M.D., Ph.D. Chung Kyu-Hyung.

Changes of Ocular Surface in a Rabbit Model of Short Term Desiccating Stress Wei-Li Chen, MD, PhD Associate Professor, National Taiwan University Hospital.

Evaluation of Epithelial Changes in Limbal Stem Cell Deficiency Using in Vivo Confocal Microscopy ERIC CHAN, Luxia Chen, Sophie X. Deng Cornea and Uveitis.

Ki Cheol Chang, MD 1, 2, Mee Kum Kim, MD 1, 2, Won Ryang Wee, MD 1,2, Jin Hak Lee, MD 2,3, Beom Seok Jeon, MD 4 Department of Ophthalmology, Seoul National.

The authors have no financial interest

Pachymetric changes during corneal collagen cross-linking and effect of hydroxipropylmethylcellulose on corneal thickness Faik Oruçoğlu (Orucov) Kudret.

Mee Kum Kim 1,2, Kyoung Min Lee 1,2, Young Eun Lee 1,2, Won Ryang Wee 1,2 1 Department of Ophthalmology, Seoul National University College of Medicine,

Eun Chul Kim, M.D., Man Soo Kim, M.D. Department of Ophthalmology & Visual Science, College of Medicine, Catholic University of Korea, Seoul, Korea The.

Clinical outcomes of Epi-LASIK : 1-Year-Long Results of Flap ON/OFF with Mitomycin-C ON/OFF Gil-Joong Yoon (MD/PhD) 1 Seong-Taeck Kim (MD) 2 Jae-Woong.

Young Joo Shin, 1 Sang Mok Lee, 2 Jin Choi, 3 Eun Ryung Han, 4 Dong Hae Kim 4 1 H ally m University Gangnam Sacred Heart Hospital 2 3The Armed Forces Medical.

Inhibition of Experimental Corneal Neovascularization by Bevacizumab (Avastin) Baskent University, School of Medicine Department of Ophthalmology, Ankara.

Different epithelial cleavage planes produced by various epikeratomes in Epi-LASIK Doh Lee, M.D., Ph.D. 1, Suk kyue Choi, M.D. 1, Jin Hyoung Kim, M.D.

Quantification of Soluble Cytokines in Sjögren Disease, non Sjögren dry eye and Healthy Subjects M. Jaimes 1B, C. Santacruz-Valdes 1B, Y. Garfias 1A, T.

Endothelial Keratoplasty in Patients With an Anterior Chamber Intraocular Lens: A Montreal Experience Georges M. Durr, MD 1,2 Johanna Choremis, MD, FRCSC.

Prevalence of Dry Eye Disease among Elderly Korean Population Sang Beom Han, MD, 1 Joon Young Hyon, MD, 1 Won Ryang Wee, MD, 2,3 Jin Hak Lee, MD, 1, 3.

The effect of TLR on transplantation and tolerance of the cornea Mee Kum Kim M.D 1, Jinho Jeong M.D 1, Won Ryang Wee M.D 1, Jin Hak Lee M.D 2 1 Department.

1 Non-contact Specular Microscopy for Evaluation of Corneal Endothelium in Early Fuchs’ Endothelial Corneal Dystrophy Jianyan Huang 1, MD, PhD; Tudor Tepelus.

*Kagithane State Hospital,Department of Ophthalmology,Istanbul, Turkey DR.GÖKHAN KAYA *Kagithane State Hospital,Department of Ophthalmology, No author.

IOL Calculations Based on Partial Biometry in Humanitarian Missions Joseph Schmitz, MD Kimberly Davis, MD, FACS Scott McClatchey, MD The authors have no.

Wound Architecture and Wound Healing after Torsional and Longitudinal Phaco in a Rabbit Model Carolina Eyecare Physicians, LLC Research Assistant Professor.

Ahmed El-Massry, M.D. Professor of Ophthalmology - Faculty of Medicine University of Alexandria Egypt long-Term Results of Corneal Biomechanical Changes.

No author has any financial or proprietary interest in any materials or methods mentioned Seung Hyun Kim M.D. ; Tae Hoon Oh M.D. Department of Ophthalmology.

Neither of authors has a financial or

Augenabteilung am St. Franziskus Hospital Münster The Role of the Epithelial Flap in EPI-LASIK and LASEK Suphi Taneri Travel Grant from B&L ASCRS Symposium,

Augenabteilung am St. Franziskus Hospital Münster Influence of Epithelial Flap on LASEK and Epi-LASIK Suphi Taneri, Saskia Oehler Authors have no financial.

Hongseok Yang, MD Department of Ophthalmology, Ajou University School of medicine, Suwon, Korea The author has no financial interest.

Normal skin tissue Supplementary Fig 1A KLF4 has a tumor suppressive function in human skin cancer. Skin cancer tissues were deparaffinized and IHC was.

Spatial Differences in Blood vs. Lymphatic Growth into the Cornea Amir Reza Hajrasouliha MD, Zahra Sadrai MD, Reza Dana MD, MPH, MSc. Schepens Eye Research.

Simulated Experiments on IOL Power Calculation Using Anterior Segment OCT Dong Hyun Jo, M.D., 1,2 Mee Kum Kim, M.D., 1,2 Won Ryang Wee, M.D. 1,2 1 Department.

Clinical Features and Outcome of Primary Amyloidosis in Korea Kihyun Kim, Seok Jin Kim, Hyun Jung Jun,Yeung-Chul Mun, Chul Soo Kim, Jong-Ho Won, Soo-Mee.

Correlation of in-vivo confocal microscopy findings with clinical severity of aniridia related keratopathy. Mandal N 1 Shortt A.J. 1,2,3 1. Cornea and.

The results of PTK using Fourier-Domain Optical Coherence Tomography for Granular Corneal Dystrophy Type 2 Eung Kweon Kim, MD, Ph.D 1 ; Tae-im Kim, MD,

The Detection of expressed IL-32 in the Human Stomach Cancer using an ELISA and Immunostaining. Seo, Eun-Hee October 6, 2008 Lab of Cell Biol& ImmunoBiochem.

Department of Ophthalmology, University of Ulsan College of Medicine,

International Neurourology Journal 2014;18:

Selective laser trabeculoplasty in Korean eyes with medically uncontrolled pseudoexfoliation glaucoma Su Chan Lee1, Jung Hyun Lee1,

Characteristics of Primary Angle-Closure Glaucoma Patients with Normal Intraocular Pressure at the First Visit Won Hyuk Oh1, Bum Gi Kim1, Joo Hwa Lee2.

From: Low Levels of Hydrogen Peroxide Stimulate Corneal Epithelial Cell Adhesion, Migration, and Wound Healing Invest. Ophthalmol. Vis. Sci ;52(3):

Outcome of LASIK in Pre-Descemet’s Membrane Corneal Dystrophy

Cross-Talk between Human Mast Cells and Epithelial Cells by IgE-mediated Periostin Production in Eosinophilic Nasal Polyps Dong-Kyu Kim, MD, PhD Department.

FGF-2 DAPI DMEM IL-1 FGF-2 Actin DMEM IL-1 25 KDa 20 KDa

The authors have nothing to declare

University of Ulsan College of Medicine

The authors have no financial interest

Erdr1 Attenuates Dermatophagoides farina Body Extract-Induced Atopic Dermatitis in NC/Nga Mice Kyung Eun Kim, Myung Jin Jung, Younkyung Houh, Tae Sung.

Chronic rhinosinusitis with polyps and without polyps is associated with increased expression of suppressors of cytokine signaling 1 and 3 Se Jin Park,

Volume 136, Issue 4, Pages (April 2009)

Sun Woong Kim, M.D.1, Hae Jung Sun, M.D.1,

Atypical Thymoma (World Health Organization Type B3) with Neuroendocrine Differentiation Combined with Hyperparathyroidism Hyun Sik Park, MD, Sang Wha.

Volume 23, Issue 1, Pages (January 2015)

Volume 26, Issue 1, Pages (January 2018)

The Effect of Bevacizumab and Ranibizumab Injection

JAMA Ophthalmology Journal Club Slides: Effects of Azithromycin in Patients With Meibomian Gland Disease Zhang L, Su Z, Zhang Z, Lin J, Li D-Q, Pflugfelder.

Authors have no financial interest.

Hyuck Jin Choi, Joo Youn Oh, Won Ryang Wee, Mee Kum Kim,

Effects of Stuffer DNA on the Suppression of Choroidal Neovascularization by a rAAV Expressing a mTOR-Inhibiting shRNA Steven Hyun Seung Lee, HeeSoon.

Presentation transcript:

The expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbits Taehyung Lim, MD 1,2,4, Hyuk- Jin Choi MD 1,2, Hyun Joo Lee 1,2, Mee Kum Kim, MD 1,2, Won Ryang Wee, MD 1,2, Jin Hak Lee, 2,3 Department of Ophthalmology, Seoul National University Hospital 1, Seoul, Korea Seoul Artificial Eye Center, Seoul National University Hospital Clinical Research Institute 2, Seoul, Korea Department of Ophthalmology, Bundang Seoul National University Hospital 3, Seoul, Korea HanGil Eye Hospital 4, Incheon, Korea Authors have not any financial support

Purpose To compare the expression of inflammatory cytokines in chemical- or microkeratome-assisted corneal epithelial flaps in rabbit animal models.

Subject & Methods 40 eyes of 20 New Zealand White rabbits Bilateral study Corneal epithelial flap(diameter of 5.0 mm) was made using the following ways:  Group A ; 1. A pplication of 20% alcohol for 30 seconds, 2 or 3 times 2. Corneal epithelial flap was made using a micro hoe (Katena, U.S.) 3. The flap was replaced  Group B ; 1.The flap was made using epimicrokeratome(Amadeus, 나라 Hz) 2. The flap was replaced

All the eyes wore therapeutic contact lenses and received tarsorrhaphies Eyes were enucleated at 3 days after the procedure Tissue sections were stained with H&E and immunohistochemistry (MMP-9, TNF-alpha) (hamster anti mouse TNF-alpha : Santa Cruz, sc-12744, mouse anti MMP-9, Chemicon, MAB3309) IL-6, TNF-alpha were evaluated by RT-PCR and were compared between those two groups. (Rabbit TNF-a ; Forward PRIMER : atggtcaccctcagatcagc Reverse PRIMER : ttgaccgctgaagagaacct, Rabbit IL-6 ; Forward PRIMER : tcctggagaccatcaaggagReverse PRIMER : gggtggcttcttcattcaaa )

Results H&E stain showed more irregular arrangement of epithelial basal cells in Group A than in Group B NormalGroup AGroup B

RT-PCR - The expression level of mRNA of IL-6, MMP-9, TNF- alpha showed no significant difference between those two groups Mean ± SD

Immunohistochemistry MMP-9 Negative Control, x 200Positive Control, x 200

MMP-9 (x 200) Group A Group B

Immunohistochemistry TNF-alpha Negative Control, x 200Positive Control, x 200

TNF-alpha (x400) Group A Group B

MMP-9 and TNF-alpha were expressed and were more prominent than negative control tissue in all groups There was no significant difference between two groups

Conclusion The expression of inflammatory cytokines in epimicrokeratome- assisted flap might be no different from alcohol-assisted flap, suggesting that the inflammatory response of the cornea might be similar between Epi-LASIK and LASEK.