Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have?

Slides:



Advertisements
Similar presentations
KEY CONCEPT Mutations are changes in DNA that may or may not affect observable traits/characteristics.
Advertisements

DNA (Gene) Mutations.
Chapter 8 Section 8.7: Mutations.
Mutations. General Definition Long Notes: Any change in DNA sequence is called a mutation. Abbreviated Notes (AN): Mutation (mut) = DNA sequence (seq)
Section DNA: The Molecule of Heredity
DNA and RNA Notes Part 2 Protein Synthesis.
Protein Synthesis (Transcription and Translation).
1.Using the table on Pg. 292, write the amino acid sequence that would be made according to the codons on the mRNA chain. 2.Why do you think this exact.
DNA (Gene) Mutations. What is a gene mutation? Parts of DNA will have a base (or more) missing, added, or incorrect A mistake in the genetic code Wrong.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
 Mutation – any change in DNA sequence  Can be caused by errors inside the cell ◦ Errors in  Replication  Transcription  Cell division (mitosis,
12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.
MONSTROUS MUTATIONS!!!. What is a mutation? Mutations are changes in DNA! However, these simple changes or mistakes can cause big changes in phenotypes.
MUTATIONS Section 11.3 pgs
Section 11.3 MUTATIONS Section 11.3 pgs
C11- DNA and Genes Chapter 11.
Mutations Chapter 12.4.
Genetic Changes 11.3.
Genetic Changes Chapter 11.3
Mutations Genetic Changes.
Genetic Mutations Increasing Genetic Diversity May 4, 2010.
Ch Mutations Section Objectives:
Review: DNA, Transcription & Translation
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
Section 11.3 Genetic Changes.
1 NOTES: MUTATIONS 2 MUTATIONS: MUTATIONS = changes in the DNA sequence that affect genetic information.
MUTATIONS I. VOCABULARY A. Mutation- Any change in the __________ sequence. 1. Mutations in body cells may cause _______ to be made wrong or not.
MUTATIONS & HUMAN GENETICS Chapter 11.3, Chapter 12.
Chapter 10: DNA, RNA, and Protein Synthesis. Objectives: Analyze and investigate emerging scientific issues (e.g., genetically modified food, stem cell.
Sometimes replication, transcription and translation don’t go as planned! Replication, Transcription, and Translation errors result in mutations. A mutation.
Mutations that happen during Transcription and Translation
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Biology Ch. 11 DNA and Genes DNA  DNA controls the production of proteins Living tissue is made up of protein, so DNA determines an organism’s.
Ch Mutations Section Objectives: Categorize the different kinds of mutations that can occur in DNA. Compare the effects of different kinds of mutations.
MUTATIONS. Mutations Mutation: A change in the DNA sequence (gene), that also changes the protein it codes for. In Sex Cells: can produce new traits or.
Mistakes can occur in any process. When do mistakes have stronger effects – When making a DNA? Making mRNA? Making a protein? Explain why. (Same as saying.
Mutations. Mutation effects Reproductive Cells -mutation in DNA sequence of an egg or sperm cell -mutation is passed on to offspring - possible effects.
Chapter 11 DNA. What is DNA? Living things need proteins to survive. –most proteins are enzymes DNA provides the complete set of instructions for making.
Genes in ActionSection 1 Section 1: Mutation and Genetic Change Preview Bellringer Key Ideas Mutation: The Basis of Genetic Change Several Kinds of Mutations.
12.4 Mutations Copyright Pearson Prentice Hall.. What Are Mutations? Changes in the nucleotide sequence of DNA (genetic material) May occur in somatic.
DNA (Deoxyribonucleic acid) Instructions for life Makes proteins/enzymes DNA Structure Polymer: Nucleotide subunits Nucleotides have 3 parts Sugar (deoxyribose)
From DNA to Protein. Proteins Proteins are complex 3D structures that play a key role in cell function. All controlling enzymes are made out of protein.
Genetic Changes: Mutations Chapter I. MUTATION  ANY change in an organisms DNA sequence  Causes  Errors in replication  Transcription  Cell.
12.4 Mutations.  What is a mutation and where can it occur? Inheritable change in genetic code 99.9 % are harmful, only 0.1% are helpful  Any change.
DNA Mutations Section Review DNA controls structure and function of cells because it holds the code to build all proteins. DNA transcription translation.
Mutation Notes: Chapter 11.
Section 11.3: Genetic Changes
12.4 Assessment Answers.
Mutations.
Mutations.
11.3 Mutations.
Chapter 8 Notes/ DNA and RNA
Mutations.
Mermaid Syndrome Video.
Copyright Pearson Prentice Hall
What happens when things go wrong?
Protein Synthesis.
Mutations LN #23 Ms. Garcia California Content Standard Genetics
11.3 Section Objectives – page 296
Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads! What do we.
Mutations.
4c. Know how mutations in the DNA sequence of a gene may or may not affect the expression of the gene or the sequence of amino acids in the encoded proteins.
Mutations A mutation is any change in the DNA sequence.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Mutations changes in genetic material (_____).
Mutations A mutation is any change in the DNA sequence.
11.3 Section Objectives – page 296
DNA Mutations Types & their effects.
Presentation transcript:

Mutations Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have? Number Two: Sea bass. Dr. Evil:... Rrrriiight. Number Two: They're mutated sea bass. Dr. Evil: I have one simple request. And that is to have sharks with frickin' laser beams attached to their frickin’ heads!... What do we have? Number Two: Sea bass. Dr. Evil:... Rrrriiight. Number Two: They're mutated sea bass.

Mutations Changes in the DNA occasionally occur. Almost always harmful, but VERY occasionally code for a new, good, protein/trait. Methods to protect DNA from changes are constantly active. Changes in the DNA occasionally occur. Almost always harmful, but VERY occasionally code for a new, good, protein/trait. Methods to protect DNA from changes are constantly active.

Types of Mutations A point or substitution mutation is a change in a single base pair in DNA. Normal Point mutation mRNA Protein Stop mRNA Protein Replace G with A

The effects of point mutations CAN change the amino acid that the codon codes for. Sometimes not. (Why not?) A single wrong amino acid can affect the shape of the protein. CAN change the amino acid that the codon codes for. Sometimes not. (Why not?) A single wrong amino acid can affect the shape of the protein.

Frameshift mutations Deletion –A single base lost in DNA. –mRNA would be out of position by one base. –Every codon after the deleted base would be different and thus different amino acids. Deletion –A single base lost in DNA. –mRNA would be out of position by one base. –Every codon after the deleted base would be different and thus different amino acids. mRNA Protein Frameshift mutation Deletion of U

Frameshift mutations Insertion Same thing as deletion - every amino acid after insertion would be different. Frameshift mutation because it shifts the reading of codons by one base. Insertion Same thing as deletion - every amino acid after insertion would be different. Frameshift mutation because it shifts the reading of codons by one base.

Causes of Mutations Just happen, spontaneous mistake. Caused by something else. –Mutagens cause changes in DNA. –Radiation X rays, cosmic rays, ultraviolet light, nuclear radiation Cause deletions –Chemicals Dioxins, asbestos, benzene, formaldehyde (gasoline, old insulation, refrigerants, preservatives) Cause Point or Substitution mutations –High temperatures. Just happen, spontaneous mistake. Caused by something else. –Mutagens cause changes in DNA. –Radiation X rays, cosmic rays, ultraviolet light, nuclear radiation Cause deletions –Chemicals Dioxins, asbestos, benzene, formaldehyde (gasoline, old insulation, refrigerants, preservatives) Cause Point or Substitution mutations –High temperatures.

Repairing DNA Enzymes proofread DNA, replace incorrect nucleotides. –Not perfect. –Greater the exposure to a mutagen the more likely a mistake will not be corrected. Enzymes proofread DNA, replace incorrect nucleotides. –Not perfect. –Greater the exposure to a mutagen the more likely a mistake will not be corrected.

Mutations in body cells Damage not passed on to offspring. May cause problems for the individual. –Impair the function of the cell –Cell divides, new cells also will have mutation –Could affect genes that control cell division = cancer. Damage not passed on to offspring. May cause problems for the individual. –Impair the function of the cell –Cell divides, new cells also will have mutation –Could affect genes that control cell division = cancer.

Mutations in reproductive cells Mutation in a sperm or an egg cell. Offspring affected. –New beneficial protein/trait (VERY rare) –Defective protein –Nonfunctional protein - embryo death Mutation in a sperm or an egg cell. Offspring affected. –New beneficial protein/trait (VERY rare) –Defective protein –Nonfunctional protein - embryo death

Chromosomal Alterations Changes may occur in chromosomes too. Called chromosomal mutations. Common in plants. Few passed on, zygote usually dies. Changes may occur in chromosomes too. Called chromosomal mutations. Common in plants. Few passed on, zygote usually dies.

Chromosomal Alterations Part of a chromosome is left out. Deletion A B C D E F G HA B C E F G H Part of a chromatid breaks off and attaches to its sister chromatid. Insertion A B C D E F G H A B C B C D E F G H

Chromosomal Alterations Part of one chromosome breaks off and is added to a different chromosome, a translocation occurs. A B E F DCBX A W C H G G E H D F W XYZYZ Translocation

Any change in DNA sequences is called a _______. Question 1 D. translation C. transcription B. mutation A. replication The answer is B.

Which is more serious, a point mutation or a frameshift mutation? Why? Question 2 Answer A frameshift mutation is more serious than a point mutation because it disrupts more codons than a point mutation.

Why are chromosomal mutations rarely passed on to the next generation? Question 3 Answer Few chromosomal changes are passed on to the next generation because the zygote usually dies. If the zygote survives, it is often sterile and incapable of producing offspring.

Question 10 The DNA sequences of a parrot _________. D. contain exactly the same nucleotides as those of a beetle C. are exactly the same as those of a human B. are more similar to a fern than a dog A. are more similar to those of a clam than a robin The answer is D.