1 Application of Algorithm Research to Molecular Biology R. C. T. Lee Dept. Of Computer Science National Chinan University
2 There is one peculiar characteristics of all living organisms: We can reproduce ourselves. Yet, it is important that what we reproduce have to be the same as we are. That is, wild flowers produce the same kind of wild flowers and birds reproduce the same kind of birds.
3 Information about ourselves must be passed to our descendants. Question: How is this done? Answer: Through DNA.
4 DNA(Deoxyribonucleic Acid) can be viewed as two strands of nucleic acids formed as a double helix.
5
6 There are only four types of nucleic acids in every DNA: A: Adenine G: Guanine C: Cytosine T: Thymine
7 Each strand of a DNA is a sequence of A, G, C and T. Yet, in each strand, A is paired with T in the other strand. Similarly, G is paired with C.
8 Human Mitochondrial DNA Control Region TTCTTTCATGGGGAAGCAAA AAGAAAGTACCCCTTCGTTT
9 DNA exists in cells. For each living organism, there are a lot of different kinds of cells. For instance, in human beings, we have muscle cells, blood cells, neural cells etc. How can different cells perform different functions?
10 Genes In each DNA sequence, there are subsequences which are called genes. Each gene corresponds to a distinct protein and it is the protein which determines the function of the cell. For instance, in red blood cells, there must be oxygen carrying protein haemoglobin and the production of this protein is controlled by a certain gene.
11 Proteins Each protein consists of amino acids. There are 20 different amino acids
12
13 The Relationship between a Gene and its Corresponding Protein
14 As shown above, each amino acid is coded by a triplet. For instance, TTC denotes PHE(Phenylalanine). Each triplet is called a codon. There are three codons, namely TAA, TGA and TAG which represent “end of gene”.
15 Protein Rnase A: KETAAAKFER Its corresponding DNA sequence is: AAA GAA ACT GCT GCT GCT AAA TTT GAA CGT
16 How Is a Protein Produced? RNA (Ribonucleic Acid) Each cell is able to recognize all of the starting points of genes relevant to the proteins important to the functions of the cell.
17 The RNA system scans a gene. For each codon being scanned, it produces a corresponding amino acid. After all codons have been scanned, the corresponding protein is produced.
18
19 AAA GAA ACT GCT GCT GCT AAA TTT GAA CGT KETAAAKFER Note that codon AAA corresponds to amino acid K and CGT corresponds to R. Remember TAA, TGA and TAG signify “end of gene”.
20 Problems 1. String Matching Problem 2. Sequence Alignment Problem 3. Evolution Tree Problem 4. RNA Secondary Structure Prediction Problem 5. Protein Structure Problem 6. Physical Mapping Problem
21 Exact String Matching Problems –Instance: A text T of length n and a pattern P of length m, where n > m. –Question: Find all occurrences of P in T. –Example: If T = “ttaptaap” and P = “ap”, then P occurs in T starting at 3 and 7. Linear time (O(n+m) time) Algorithms –Knuth-Morris-Pratt (KMP) algorithm –Boyer-Moore algorithm
22 Approximate String Matching Problems –Instance: A text T of length n, a pattern P of length m and a maximal number of errors allowed k –Question: Find all text positions where the pattern matches the text up to k errors, where errors can be substituting, deleting, or inserting a character. –Example: Let T = “pttapa”, P = “patt” and k = 2. The substrings T[1..2], T[1..3], T[1..4] and T[5..6] are up to 2 errors with P. Algorithms –Dynamic Programming approach – NFA approach
23 Sequence Alignment Problem ATTCATTACAACCGCTATG ACCCATCAACAACCGCTATG It appears that these two sequences are quite different. An alignment will produce the following: ATTCATTA-CAACCGCTATG ACCCATCAACAACCGCTATG
24 Given two sequences, any alignment will have a corresponding score. For each exact match, the score is equal to 2. For each mismatch, the score is equal to -1. AGC- AG-C AAAC AAAC 2-3=-1 2x2-2x(-1)=2
25 The sequence alignment problem: Given two sequences, find an alignment which produces the highest score. Approach: Dynamic Programming The multiple sequence alignment problem is NP-hard
26 The Evolution Tree Problem
27
28 The evolution tree problem: Given a distance matrix of n species, find an evolution tree under some criterion. Usually, the criteria are such that all of the tree distances reflect the original distances. That is, when two species are close to each other in the distance matrix, they should be close in the evolution tree.
29 Each criterion corresponds to a distinct evolution tree problem. Most of them are NP-complete. Algorithms which produce optimal evolution trees in polynomial time are mostly based upon the minimal spanning tree approach.
30 A Partial Evolution Tree of the Homo Sapien (Intelligent Human Beings, also Modern Men) Our ancestors are from Africa.
31 Secondary Structure of RNA Due to hydrogen bonds, the primary structure of a RNA can fold back on itself to form its secondary structure. Base pairs (formed by hydrogen bonds): 1.A U (Watson-Crick base pair) 2.C G (Watson-Crick base pair) 3.G U (Wobble base pair)
32 AGGCCUUCCU
33 2D & 3D Structures of Yeast Phenylalanyl-Transfer RNA 2D Structure 3D Structure
34 Secondary Structure Prediction Problem Given an RNA sequence, determine the secondary structure of the minimum free energy from this sequence. Approach: Dynamic Programming
35 Protein Structure Problem Each amino acid of a protein can be classified into either of the following two types: –H (hydrophobic, non-polar) (hating water) –P (hydrophilic, polar) (loving water) Then the amino acid sequence of a protein can be viewed as a binary sequence of H’s (1’s) and P’s (0’s).
36 Example Instance: Score = 5Score = 3
37 H-P Model Instance: A sequence of 1’s (H’s) and 0’s (P’s). Question: To find a self-avoiding paths embedded in either a 2D or 3D lattice which maximizes score, where the score is the number of pairs of 1’s that are adjacent in the lattice without being adjacent in the sequence. NP-complete even for 2D lattice.
38 Physical Mapping Problem Select a subset of cosmid clones of minimum total length that covers the YAC DNA. C: Full DNA 10 8 bp Cut C and clone into overlapping YAC clones bp Fragment assembling Physical mapping Cut the DNA in each YAC clone and clone into overlapping cosmid clones bp Duplicate the cosmid and then cut the copies randomly. Select and sequence short fragments and then reassemble them into a deduced cosmid string bp
39 Shortest Common Superstring Input: A collection F of strings. Output: A shortest possible string S such that for every f F, S is a superstring of f. For example: NP-complete ACT CTA AGT ACTAGT F S
40 Suppose the target is too long and its contents are unknown. What can we do? Enzyme A {6, 8, 3, 10} Enzyme B {7, 11, 4, 5} Enzymes A and B {1, 5, 2, 6, 7, 3, 3}
41 A B AB This problem is called the two digest problem which is NP-complete.
42 TAA, TGA, or TAG. Do you know what they mean? End of Gene. Thank you for your patience. Have a good conference.