Unit 4 – Lecture 4. Mutations Genetic Mutation – a change in the amount or structure of genetic material of an organism Mutations can be in DNA or can.

Slides:



Advertisements
Similar presentations
Unit 4 – Lecture 4. Mutations Genetic Mutation – a change in the amount or structure of genetic material of an organism Mutations can be in DNA or can.
Advertisements

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring, only to descendant cells)
Section 1: Mutation and Genetic Change
12.4 MUTATIONS I. Kinds of Mutations
Human Genetic Mutations
 The sequences of bases in DNA are like the letters of a coded message… what would happen if a few of those letters changed accidentally, altering the.
8.7 – Mutations. Key Concept  Mutations are changes in DNA that may or may not affect phenotype. mutated base.
12-4 Mutations Mutation: A Change in DNA Mutation – any change in the DNA sequence that can also change the protein it codes for Mutations in Reproductive.
MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.
MUTATIONS Section 11.3 pgs
Section 11.3 MUTATIONS Section 11.3 pgs
Mutation and Genetic Change
Lesson Overview 13.3 Mutations.
Mutations And their effects. A mutation is…  A permanent change that occurs in a cell’s DNA.
MUTATIONS.
Mutations. A Mutation is a change in an organism’s DNA  It can occur naturally whenever a base is incorrectly copied, especially during DNA Replication.
Mutations. What comes to mind???? Mutants.
Genes and Gene Mutations. Gene: a sequence of DNA bases that code for a product, usually a protein. Gene mutation: a change in the sequence of bases.
MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.
Genes in ActionSection 1 Section 1: Mutation and Genetic Change Preview Bellringer Key Ideas Mutation: The Basis of Genetic Change Several Kinds of Mutations.
Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.
13.3 Mutations KeyQuestions: 1)What are mutations? 2)How do mutations affect genes? The sequence of bases in DNA are like the letters of a coded message.
Lesson Overview 13.3 Mutations. THINK ABOUT IT The sequence of bases in DNA are like the letters of a coded message. What would happen if a few of those.
8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.  May occur in somatic cells (aren‘t passed to offspring)
MUTATIONS! Part One. MUTATIONS: WHAT ARE THEY ? MUTATIONS: w are changes in the genetic material of the cell. w can occur at the level of an individual.
Mutations. What Are Mutations? MUTATION = A change in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur.
CHAPTER 14 SECTION 1 Mutations. Are mutations good or bad?  Some mutations lead to genetic disorders  Some mutations may cause a beneficial trait 
Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.
Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.
A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.
Mutations: Definition: Changes in DNA in an organism. These changes can be problematic, can be helpful, or can have no effect. Mutations are what DRIVES.
MUTATIONS Where, when, why, and how?.
Chromosomal Disorders
12.4 Assessment Answers.
Section 1: Mutation and Genetic Change
Lesson Overview 13.3 Mutations.
Lesson Overview 13.3 Mutations.
Mutation Notes Chapter 12-4.
Chapter 14 GENETIC VARIATION.
Mutations.
Mutations and Genetic Disorders
Mutations.
Mutations.
DNA Mutations & Disorders
Gene Mutations.
Mutation and Genetic Change
Mutations.
Types of point mutations
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations -changes in a single base pair in DNA=changes in the nucleotide.
UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms?  Mutations Alternative alleles (traits) of many genes result from changes.
Mutations.
Mutations Any change in an organism’s DNA. Mutations in somatic cells only impact individual; mutations in gametes may impact offspring. 2 Types: A. Gene.
Section 1: Mutation and Genetic Change
Mutations.
Ch 12-4 Genetic Mutations.
Lesson Overview 13.3 Mutations Objectives:
Mutations.
What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?
Draw a conclusion from this graph for both the red and blue line
Chapter 12-4 DNA Mutations.
DNA: The Blueprints For Life
13.3 Mutations.
Genes & Mutations Miss Richardson SBI4U.
C-Notes: Mutations Stnd: BI.4.c 10/23/13
Lesson Overview 13.3 Mutations.
Mutations.
Lesson Overview 13.3 Mutations.
Lesson Overview 13.3 Mutations.
Presentation transcript:

Unit 4 – Lecture 4

Mutations Genetic Mutation – a change in the amount or structure of genetic material of an organism Mutations can be in DNA or can be chromosomal Mutations can happen more than once in a sequence [and typically do] Causes: mutagens – radiation or chemical substances that increase the rate of mutations

Mutations [Causes:] problem during interphase when DNA is being replicated problems are typically noticed and repaired by enzymes during growth typically mismatch in base pairing problem in DNA  problem in mRNA  problem in protein synthesis

Effects of Mutations ALL known mutations are harmful overall some are beneficial under certain circumstances antibiotic resistance: immunity to antibiotics often slow reproduction often poor acquisition of resources

Effects of Mutations ALL known mutations are harmful overall some are beneficial under certain circumstances sickle-cell anemia: less likely to get malaria obstruction of blood vessels organ damage life span 42-48yrs old

Effects of Mutations Small changes: may cause no change in the a.as formed may cause a change in the a.as formed may cause MASSIVE change in the a.asformed Large changes…are of course, typically worse than small changes

Effects of Mutations Can cause cancers, genetic disorders Mutations in cells: in gametes – passed to the next generation in somatic cells – not passed on to next generation

Discuss What are substances that cause mutations called? A mutation in a _____ cell will be passed on to offspring, but a mutation in a _____ cell will NOT be passed on to offspring.

DNA Mutations 3 types (1) – BY CAUSE substitution – change of a single base from one kind to another [aka point mutation] ex: THE DOG RAN OUT  THE FOG RAN OUT may or may not alter the amino acid formed: CAU & CAC both code for Histidine CAA & CAG both code for Glutamine UUU = phenylalanine UUA = leucine

DNA Mutations 3 types (2) – BY CAUSE deletion – a single base is deleted from the sequence THE DOG RAN OUT  THE OGR ANO UT changes the sequence of codons – usually quite a bit; but may not change sequence if next letters code for same thing [like near end] TAC – UUA – UAA  TAC – UUU – AA Met – Leu – [stop]  Met – Phe –

DNA Mutations 3 types (3) – BY CAUSE insertion – a single base is added to the sequence THE DOG RAN OUT  THE DOG RAF NOU T changes the sequence of codons – usually quite a bit; but may not change sequence if next letters code for same thing [like near end] TAC – UUA – UAA  TAC – UUA – AUA – A Met – Leu – [stop]  Met – Leu – Ile –

Discuss Name AND explain the three types of mutation by their CAUSE.

DNA Mutations 4 classifications (1-2) – BY EFFECT silent (sense) – has no effect on amino acid sequence AGU (serine)  AGC (serine) missense – codes for a different amino acid AGU (serine)  AGA (arginine)

DNA Mutations 4 classifications (4) – BY EFFECT nonsense forms premature “stop” codon UAC (tyrosine)  UAG (stop)

Discuss Name AND explain the three types of mutation by their EFFECT.

DNA Mutations …ALSO AN EFFECT…BUT WANTED TO PUT AFTER frameshift – changes the “reading frame” caused by insertion/deletion THE DOG RAN OUT  THE OGR ANO UT THE DOG RAN OUT  THE DOG RAF NOU T insertions/deletions in groups of three may not change reading frame, but can change amino acids formed causing protein to not function properly.

Chromosomal Mutations Recall: Chromosomes are wound DNA – when chromosomes are altered, we are altering large portions of the DNA message, even if there is only a small change to the chromosome.

Chromosomal Mutations Occur during meiosis 4 types: (1) deletion – piece of chromosome is lost may be lethal depending on which gene is lost

Chromosomal Mutations Occur during meiosis 4 types: (2) duplication – piece of chromosome is duplicated often harmless

Chromosomal Mutations Occur during meiosis 4 types: (3) inversion – piece of chromosome is inverted/flipped typically lethal, but in rare cases is advantageous

Chromosomal Mutations Occur during meiosis 4 types: (4) translocation – piece of chromosome is moved to another part of the same chromosome or moved to its homologue typically lethal

Discuss Name AND explain the four types of chromosomal mutations.

Non-Disjunction Non-disjunction – pairs of chromosomes don’t separate properly during meiosis [metaphase] Metaphase I – ALL gametes affected

Non-Disjunction Non-disjunction – pairs of chromosomes don’t separate properly during meiosis [metaphase] Metaphase II – only half of gametes affected

Non-Disjunction Non-disjunction – pairs of chromosomes don’t separate properly during meiosis [metaphase] causes types of “monosomy” or “trisomy” ex: Trisomy-21, Trisomy-X, Monosomy-X, Showing Trisomy

Discuss Explain the phenomenon of non-disjunction.

Polyploidy Polyploidy – multiples of entire chromosome set. lethal in humans, common in plants plants: causes larger cells, larger plants Examples: peanuts = 4n sugar cane = 8n coffee = 2n, 4n, 6n, 8n wheat = 6n

Polyploidy