Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State.

Slides:

Advertisements

Similar presentations

Leading Producers of Strawberries

Advertisements

Integrated Disease Management Disease Resistance and Cultural Controls.

1.9 Case study: Integrated management of Alternaria blight in carrots

Factors Involved in Full Season Scab Management Jason Brock Department of Plant Pathology UGA – Tifton 2010 Georgia Pecan Growers Association Annual Meeting.

Pulse Disease Concerns in Montana Dr. Mary Burrows Montana State University, Bozeman, MT

Foliar Fungicide Management for Corn Production Brian Jones Agronomy Extension Agent.

Plant Diseases Meghan Danielson.

Disarm®O Fungicide “Broad-spectrum control of foliar and soil-borne diseases”

DISCLAIMER The forecast herein is made with state of the art computer modeling technology. However, the models do not guarantee accuracy or certainty of.

Managing Tomato Diseases in High Tunnels

Achour Amiri, Philip F. Harmon, Natalia A. Peres Winter BGA meeting, Plant City, FL, 02/20/14 Early signs of widespread fungicide resistance in Botrytis.

Etiology and Management of Rind Breakdown of Mandarins J.H. Connell, University of California Cooperative Extension, Butte County, Oroville, California.

Demonstration and Evaluation of Integrated Crop Scouting on Pumpkins in Southern NJ Sally Walker Rutgers Cooperative Extension Vegetable IPM Program.

Strawberry Disease Monitoring and Forecasting System Clyde Fraisse Willigthon Pavan Natália Peres University of Florida Climate Prediction Applications.

Tomato Diseases Fungal Bacterial Viral

Powdery Scab in SA: What’s New? Jacquie van der Waals Department of Microbiology and Plant Pathology.

Root Galls formed by Root-knot Nematodes

Wheat Management Mike Roegge University of Illinois Extension Adams/Brown Unit With special thanks to Dr. Carl Bradley, Dr. Steve Ebelhar, Dr. Eric Adee.

Precision Crop protection In Bachelor Class Precision Farming 2012 Rob kerkmeester Meeting 1.

Validation, Optimization, and Deployment of Fungicide Advisories for Soybean Virginia Soybean Board 2014 Project Report & 2015 Project Proposal Dr. Hillary.

Grafting can provide a site-specific management tool for some soilborne diseases. High Tunnels provide ~25 days early season extension over field- planted.

1.5 Prediction of disease outbreaks

Management of blueberry rust HAL BB13002

Plant tissue analysis for testing nutrients deficiency in Mango

Unit 10: Soybean Diseases.  Bacterial Blight Occurs on leaves of the SB  Small angular spots  Appear yellow at first  Later turn brown to black 

Clyde Fraisse Agricultural & Biological Engineering Climate Information & Decision Support Systems.

Sergio Tonetto de Freitas and Elizabeth J. Mitcham Department of Plant Sciences, University of California, Davis, CA USA

INCIDENCE AND SEVERITY OF BEAN ANTHRACNOSE BY Colletotrichum lindemuthianum ON VARIED AGES OF COMMON BEAN (Phaseolus vulgaris L) INOCULATED USING DIFFERENT.

1 Cotton 2005 Ouachita Fertilizer River Parishes.

Diseases Unit: Plant Pests. Objectives: 1)Explain diseases as related to plants 2)Describe the types and causes of plant diseases 3)Explain how common.

Site-Specific Weather Data for Disease Forecasting: Reality or Pipe Dream? Bob Seem Cornell University New York State Agricultural Experiment Station Geneva,

Scientific Name : (Vaccinium spp.) are a member of the heath family (Ericaceae), grown as a perennial crop. Blueberries have a blue to blue-black epidermis.

Mechanical Harvesting of Southern Highbush Blueberries and Postharvest Disease Relationships Part of comprehensive 4-year research/ extension project to.

2012 Pecan Disease Management Update Jason Brock Dept

1.3 Assessment of disease intensity Introduction and definitions Methods for assessing disease intensity Methods for analyzing disease records Methods.

Plant Disorders Diseases. Powdery Mildew The disease is easily recognizable as a white to gray powdery growth on leaves and sometimes stems and flowers.

Pumpkin Diseases and Insects Powdery mildew (Sphaerotheca fuliginea) A foliar fungus that causes defoliation, resulting in reduced yields and fruit quality.

Positive products for control of rice blast disease Mwangi J.K, - UOK Wanjogu R.K,Owilla B.P.O, -MIAD.

for testing nutrients deficiency in grape

Almost Everything You Want to Know About Stink Bugs and What You Better Know about Roundup Ready Cotton Certified Crop Advisor Training January 22, 2002.

1.1 Introduction to integrated disease management Introduction Effects of control measures on disease progress Effects of control measures within the plant.

Weather-based Disease Risk Assessment in Turf Review unique aspects of turf environment Discuss attempts to develop WB systems for turf Describe system.

Disease Management Jason Brock Department of Plant Pathology.

Diseases of Beans and Peas Root Rots Fusarium solani f. sp. phaseoli f. sp. pisi Beans and peas, respectively Soilborne Favored by wet or poorly drained.

“A disease forecast system for timing fungicide applications to control strawberry fruit rots” Natalia Peres and Steve Mackenzie, Natalia Peres and Steve.

Assessment of Agreement between SkyBit Predictions and On-site Measurements Henry K. Ngugi, PhD. Penn State Fruit Research & Extension Center, Biglerville,

Damon L. Smith and Andrea F. Payne Department of Entomology and Plant Pathology, Oklahoma State University Stillwater, OK.

North American Cranberry Fruit Rot Working Group

1 Cotton 2005 Ouachita Fertilizer Red River. 2 Ouachita Commitment to you Increase yields Lower Costs / Unit Produced Help solve specific production problems.

Milsana ® Fungicide Nick Macris Director, Business Development (727) (mobile) (530) (office)

California Rice Pest Update Christopher A. Greer University of California Cooperative Extension Big Valley Ag Services Rice Grower Meeting Yuba City, CA.

PEACH BLOSSOM BLIGHT Biology, Control, and

Monitoring Risk for Bitter Rot and Apple Scab Kirk Broders Assistant Professor Dept. of Biological Sciences, COLSA University of New Hampshire Matt Wallhead.

Strawberry Disease Management: Fungicides for Fruit Pathogens Steven Koike and Mark Bolda University of California Cooperative Extension Monterey County.

Disease management in high tunnels and greenhouses

Best Management Practices for Anthracnose Control

NDVI Active Sensors in Sugarbeet Production for In-Season and Whole Rotation Nitrogen Management.

Agent In-Service Training - Effective gray mold management

Supplemental Figure 1 A) B) C)

Noor A. Abdelsamad 1, Gustavo C. MacIntosh2, and Leonor F. Leandro 1

Long-term crop rotations suppress soybean sudden death

Jan Nechwatal & Michael Zellner

Southern California Pomology Research Update

Damon L. Smith and Andrea F. Payne

POSTHARVEST PATHOLOGY

Management of Wilt Diseases on Tomato by Organically Acceptable Methods MM Rahman and Lewis Jett, WVU Extension Service, Morgantown, WV

Volume 2, Issue 1, Pages (January 2009)

Presentation transcript:

Recent advancements in strawberry integrated disease management in NC Mahfuzur Rahman and Frank Louws Department of Plant Pathology North Carolina State University

Host resistance mechanism against Anthracnose caused by Colletotrichum acutatum

Anthracnose ripe fruit rot Lesions are more sunken under dry condition while salmon color spore mass is common under high relative humidity on less sunken lesions

All parts of strawberry are susceptible to C. acutatum Anthracnose petiole rot, flower blight & green fruit rot Symptom on green fruit

AFR incidence on 14 genotypes in plasticulture system, ‘07 & ‘08

Invitro evaluation of anthracnose fruit rot severity

Rank sum method  a, b and c are genotype ranking using lesion diameter at 8 DAI from three different experiments;  d= rank-sum (a + b +c) for each genotype;  e = deviation from the grand mean (G) of the rank-sums ([e = (d –G)/standard deviation] × 3).

Invitro AFR resistance Seascape is a day-neutral (everbearing) cultivar NC C02-63 is a short-day advance breeding line

Selection of genotypes possessing QI and AFR resistance

Variability in overall resistance explained by true fruit resistance and resistance quiescent infection a Confidence limit Resistance typeR2R2 Adjusted R 2 Approx 95% CL a for R 2 F- value Pr>F Lower CLUpper CL Lesion diameter Quiescent infection severity

Correlation of field AFR incidence with induced level of defense enzyme

Detection and quantification of Colletotrichum spp from quiescent infections

Development of a real time PCR protocol for QI The primer/probe set and capture probe was designed from the consensus sequence using Beacon Designer software from 45 ITS sequences of C. acutatum and C. gloeosporioides. b DMT-Difference in melting temperature of amplicons from C. acutatum and C. gloeosporioides template when reverse primer is used with different combinations of forward primers.

Species discrimination by melt curve analysis glo GCTTGGTGTTGGGGCCCT ACAGCTGATGT AGGCCCTCAAAGGTAGTGGCGGACCCTCCCG acu GCTTGGTTTT GGGGCCCCACGGCCGACGTGGGCCCTT AAAGGTAGTGGCGGACCCTCCCG glo GAGCCTCCTTTGCGTAGTAACTTT ACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT acu GAGCCTCCTTTGCGTAGTAACT - AACGTCTCGCACTGGGATCCGGAGGGACTCTTGCCGT glo AAAACC acu T AAACC SNP classBase changeTypical T m melt curve shift 1C/T and G/ALarge (>0.5°C) 2C/A and G/T 3C/G 4A/TVery Small (<0.2°C) Primer binding site

Melt curve (HRM) analysis in Rotor gene 6000 qPCR system C. gloeosporioidesC. acutatum

Utilization of the tool in assessing field samples  Superior detection capacity  Superior in terms of “sensitivity, specificity and speed”  Lowest detection limit is 5 cfu/1pg

AFR prediction based on foliar quiescent infection 2009 No AFR

Chemical control of AFR 2008 Treatments and rates (units product/A)Schedule AFR Inc (%) Yield (M) (lb/A) Not-treated…………………………………… a12,685 c Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Abound 25 SC..………………………………. Spray# 1 Spray# 2,4 Spray# 3,5,7,9 Spray# 6, c20,151 a Captan 50WP 4.0 lb + Topsin-M 70 WP 1.1lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb……………………. Spray# 1 Spray# 2,4 Spray# bc18,130 ab Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lb Distinguish 16 fl. oz………………………….. Spray#1,3,5,7,9 Spray#2,4,6, b16,832 abc Captan 50 WP 4.0 lb +Topsin-M 70WP 1.1 lb Abound 25 SC……………………………….. Spray#1,3,5,7,9 Spray#2,4,6, a16,135 abc

Efficacy of reduced spray schedule and premixed active ingredients ‘09 Fungicide rate (formulation/acre) z *Schedule y AFR Inc(%) w,x Yield/plant(g) w Non-treated……………………………………xxx a c Captan 50 WP 4.0 lb + Topsin M 70 W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Abound 25 SC..………………………………. spray #1 spray #2,4 spray # 3,5,7 spray # 6, c ab Captan 50 WP 4.0 lb + Topsin M 70 W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb…………………….. spray #1 spray #2,4 spray # bc ab A16001EW 14.0 fl Oz Captan 50 WP 4.0 lb………………………….. Spray#1,2,4,5 Spray# b bc A13703 SC14.0 fl Oz Captan 50 WP 4.0 lb………………………….. Spray#1,2,4,5 Spray# b a A16001EW = a premix of difenoconazole + cyprodinil (Inspire Super). A13703 = a premix of difenoconazole + azoxystrobin (Quadris Top).

Precision disease management for sustainable strawberry production in the Southeast U.S/Prediction based spray program  The variable %INF is calculated from the equation:  In (%INF / [1-%INF]) = W – 0.069WT WT2 – 0.93 x 10 – 4 WT3 where W = the duration of a preceding wetness interval and T= mean temperature( 0 C) during the interval.  If threshold expressed by %INF is 0.15 will indicate the need for Captan spray  When threshold reaches 0.50 will indicate the need for pyraclostrobin spray

Skybit weather forecast E-WEATHER FORECAST AND SUMMARY For: NC-NEW HANOVER-CASTLE HAYNE Date: THU JUN 3, 2010 DATE Jun 3 Jun 4 HOUR (EDT) 8a 11a 2p 5p 8p 11p 2a 5a 8a 11a 2p 5p 8p 11p TEMP (F) "- SOIL TEMP (F) REL HUM (%) HR PRECIP(in).00/.00/.00/.00/.00/.00/.00/ 6HR PRECIP PROB(%) 19/ 13/ 22/ 13/ 16/ 9/ 23/ 3HR EVAP (in) HR WETNESS (hrs) WIND DIR (pt) SSW SW SSW SSW SSW SSW SSW SW WSW WSW SSW S SSW SW WIND SPEED (mph) CLOUD COVER OVC BKN BKN BKN SCT BKN BKN BKN BKN SCT SCT BKN OVC OVC 3HR RADIATION (ly) PCT RADIATION (%)

HOBO leaf wetness smart sensor SENSOR

Determination of wetness hours

Prediction based spray schedule Treatments# of sprays applied AFR inciden ce (%) ab Marketable yield (lb/plant) b Non treated control-8.45 a0.73 b Regular Schedule Captan 50WP 4.0 lb + Topsin M 70W 1.0 lb Pristine WG 1.45 lb CaptEvate 68WDG 4.5 lb Pristine WG 1.45 lb ……………………… 1 2, 4 3, 5, 7 6, b0.87 a Prediction based schedule Captan 50WP 4.0 lb Pristine WG 1.45 lb b0.75 ab a Disease incidence was calculated from all harvested fruits over 8 weeks b Means in a column followed by the same letter are not significantly different by Fisher’s protected LSD test (α ≤ 0.05).

Host Resistance Integrated Strawberry Disease Management Reduced spray schedule Optimum fertility Calcinit-Ca(NO 3 ) 2 Treatment (rate/A) Schedule y Gray mold (%) Non-treated…n.a.17.8 a Captan + Topsin-M Pristine Switch Pristine…….. Spray# 1 Spray#2 Spray#3 Spray# b Captan+ Topsin-M Pristine Switch………. Spray# 1 Spray# 2,4,6,8 Spray# 3,5,7,9 6.1 b ing stock Removal of senesced tissue & Sensitive Detection Tool Quiescently Infected – exclude from planting stock Infected fruits Weather based Prediction

Acknowledgements  Mike Carnes and Jim Driver  NC strawberry growers association  North American Strawberry growers association  California strawberry commission  Southern region IPM center  SkyBit - ZedX, Inc SkyBit - ZedX, Inc.