CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data.

Slides:

Advertisements

Similar presentations

Tandem MS (MS/MS) on the Q-ToF2

Advertisements

Genomes and Proteomes genome: complete set of genetic information in organism gene sequence contains recipe for making proteins (genotype) proteome: complete.

From Genome to Proteome Juang RH (2004) BCbasics Systems Biology, Integrated Biology.

UC Mass Spectrometry Facility & Protein Characterization for Proteomics Core Proteomics Capabilities: Examples of Protein ID and Analysis of Modified Proteins.

In-depth Analysis of Protein Amino Acid Sequence and PTMs with High-resolution Mass Spectrometry Lian Yang 2 ; Baozhen Shan 1 ; Bin Ma 2 1 Bioinformatics.

BIOINFORMATICS Ency Lee.

Mass Spectrometry in a drug discovery setting Claus Andersen Senior Scientist Sienabiotech Spa.

B IOINFORMATICS S UMMER A CADEMY J UNE

Protein Sequencing and Identification by Mass Spectrometry.

Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.

CSE182-L12 Gene Finding.

Proteomics: A Challenge for Technology and Information Science CBCB Seminar, November 21, 2005 Tim Griffin Dept. Biochemistry, Molecular Biology and Biophysics.

STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2015 Xiaole Shirley Liu Please Fill Out Student Sign In.

Announcements: Proposal resubmissions are due 4/23. It is recommended that students set up a meeting to discuss modifications for the final step of the.

Previous Lecture: Regression and Correlation

Proteomics Informatics (BMSC-GA 4437) Course Director David Fenyö Contact information

My contact details and information about submitting samples for MS

Proteomics Josh Leung Biology 1220 April 13 th, 2010.

Proteomics Informatics (BMSC-GA 4437) Course Director David Fenyö Contact information

Evaluated Reference MS/MS Spectra Libraries Current and Future NIST Programs.

Tryptic digestion Proteomics Workflow for Gel-based and LC-coupled Mass Spectrometry Protein or peptide pre-fractionation is a prerequisite for the reduction.

PROTEIN STRUCTURE NAME: ANUSHA. INTRODUCTION Frederick Sanger was awarded his first Nobel Prize for determining the amino acid sequence of insulin, the.

GSAT501 - proteomics Name, home-town Students – previous lab experience –Lab you hope to end up in? Teachers – what is your current project.

Doug Raiford Lesson 3.  More and more sequence data is being generated every day  Useless if not made available to other researchers.

Common parameters At the beginning one need to set up the parameters.

Analysis of Complex Proteomic Datasets Using Scaffold Free Scaffold Viewer can be downloaded at:

A Comprehensive Comparison of the de novo Sequencing Accuracies of PEAKS, BioAnalyst and PLGS Bin Ma 1 ; Amanda Doherty-Kirby 1 ; Aaron Booy 2 ; Bob Olafson.

Laxman Yetukuri T : Modeling of Proteomics Data

Lecture 9. Functional Genomics at the Protein Level: Proteomics.

Overview of Bioinformatics 1 Module Denis Manley..

WMU CS 6260 Parallel Computations II Spring 2013 Presentation #1 about Semester Project Feb/18/2013 Professor: Dr. de Doncker Name: Sandino Vargas Xuanyu.

Genomics II: The Proteome Using high-throughput methods to identify proteins and to understand their function.

Software Project MassAnalyst Roeland Luitwieler Marnix Kammer April 24, 2006.

PEAKS: De Novo Sequencing using Tandem Mass Spectrometry Bin Ma Dept. of Computer Science University of Western Ontario.

Proteomics What is it? How is it done? Are there different kinds? Why would you want to do it (what can it tell you)?

Central dogma: the story of life RNA DNA Protein.

CSE182 CSE182-L11 Protein sequencing and Mass Spectrometry.

1 From Mendel to Genomics Historically –Identify or create mutations, follow inheritance –Determine linkage, create maps Now: Genomics –Not just a gene,

A New Strategy of Protein Identification in Proteomics Xinmin Yin CS Dept. Ball State Univ.

Bioinformatics Project BB201 Metabolism A.Nasser

__________________________________________________________________________________________________ Fall 2015GCBA 815 __________________________________________________________________________________________________.

Proteomics Informatics (BMSC-GA 4437) Instructor David Fenyö Contact information

An Introduction to NCBI & BLAST National Center for Biotechnology Information Richard Johnston Pasadena City College.

BIOL 433 Plant Genetics Term 2, Instructors: Dr. George Haughn Dr. Ljerka Kunst BioSciences 2239BioSciences Tel

Proteomics Informatics (BMSC-GA 4437) Course Directors David Fenyö Kelly Ruggles Beatrix Ueberheide Contact information

STAT115 STAT215 BIO512 BIST298 Introduction to Computational Biology and Bioinformatics Spring 2016 Xiaole Shirley Liu.

Bioinformatics Professor: Monica Bianchini Department of Information Engineering and Mathematics E–mail: Phone: 1012.

Peptide de novo sequencing Peptide de novo sequencing is the analytical process that derives a peptide’s amino acid sequence from its tandem mass spectrum.

BLAST: Basic Local Alignment Search Tool Robert (R.J.) Sperazza BLAST is a software used to analyze genetic information It can identify existing genes.

BNFO 615 Fall 2016 Usman Roshan NJIT. Outline Machine learning for bioinformatics – Basic machine learning algorithms – Applications to bioinformatics.

Protein identification by mass spectrometry The shotgun proteomics strategy, based on digesting proteins into peptides and sequencing them using tandem.

Protein identification by mass spectrometry The shotgun proteomics strategy, based on digesting proteins into peptides and sequencing them using tandem.

Research Paper on BioInformatics

CSE182-L12 Gene Finding.

Bioinformatics Solutions Inc.

Overview Bioinformatics: Analyzing biological data using statistics, math modeling, and computer science BLAST = Basic Local Alignment Search Tool Input.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Geneomics and Database Mining and Genetic Mapping

Proteomics Informatics David Fenyő

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

From Mendel to Genomics

Bioinformatics for Proteomics

PatternHunter: faster and more sensitive homology search

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Proteomics Informatics David Fenyő

Kuen-Pin Wu Institute of Information Science Academia Sinica

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Presentation transcript:

CS 461b/661b: Bioinformatics Tools and Applications Software Algorithm Mathematical Models Biology Experiments and Data

Bin Ma Title: Associate Professor Research area: Bioinformatics Office hours: Tuesday 4-5pm, Wednesday 4- 5pm. Office: MC362

Bioinformatics

Class Time Monday, MC320, 2:30-4:30pm Wednesday, MC320/MC325, 3:30-4:30pm Jan. 7. An overview session. Jan. 14 (Monday), 16 (Wednesday) will be lectured by Mark Daley.

Evaluation Two assignments (10 marks each) One project (30 marks) One final exam (50 marks)

TA: ??.

Topic: Whole Genome Shotgun Sequencing Sequencing machines are used to read small fragments. Then the “reads” are assembled together. How to cut and clone. How sequencing machines work. How to assemble. DIY: assemble a small genome.

Topic: PCR and Primer Design How to select a region of DNA and make millions of copies rapidly. How to design the “primers”. Use it to identify the criminals by FBI and polices. DIY: design a primer

Topic: Gene prediction

Gene prediction How translation is done Gene structures How to find genes, the most interesting parts on a genome. DIY: find a gene using software.

Topic: NCBI Entrez Where to get biological data. Use Entrez as a comprehensive data source. DIY: download and compare sequences of the same protein in 20 different mammals.

GCNTACACGTCACCATCTGTGCCACCACNCATGTCTCTAGTGATCCCTCATAAGTTCCAACAAAGTTTGC || ||||| | ||| |||| || |||||||||||||||||| | |||||||| | | ||||| GCCTACACACCGCCAGTTGTG-TTCCTGCTATGTCTCTAGTGATCCCTGAAAAGTTCCAGCGTATTTTGC GAGTACTCAACACCAACATTGATGGGCAATGGAAAATAGCCTTCGCCATCACACCATTAAGGGTGA---- || ||||||||| |||||| | ||||| |||||||| ||| |||||||| | | | || GAATACTCAACAGCAACATCAACGGGCAGCAGAAAATAGGCTTTGCCATCACTGCCATTAAGGATGTGGG TGTTGAGGAAAGCAGACATTGACCTCACCGAGAGGGCAGGCGAGCTCAGGTA ||||||||||||| ||| ||||||||||| || ||||||| || |||| | TTGACAGTACACTCATAGTGTTGAGGAAAGCTGACGTTGACCTCACCAAGTGGGCAGGAGAACTCACTGA GGATGAGGTGGAGCATATGATCACCATCATACAGAACTCAC CAAGATTCCAGACTGGTTCTTG ||||||| |||| | | |||| ||||| || ||||| || |||||| ||||||||||||||| GGATGAGATGGAACGTGTGATGACCATTATGCAGAATCCATGCCAGTACAAGATCCCAGACTGGTTCTTG Topic: BLAST and PatternHunter sequence alignment

Homology Search Use NCBI BLAST as a tool to find similarities. Spaced seeds. How to implement the spaced seeds as computer programs. DIY: Experiment the sensitivity comparison between spaced seeds and BLAST seed.

Mass Spectrometry Genomics  Proteomics Proteins are more directly related to the functions of cells Many diseases are closely related to abnormal proteins Knowing which proteins are present in different cells under different conditions is useful Protein ID becomes an essential task in proteomics

Tandem mass spectrometry Tandem mass spectrometry (MS/MS, tandem MS) is the standard way for protein identification. LSIMQDK peptide tandem mass spectrometer MS/MS spectrum

Mass Spectrometry Principles of instruments Noises and complications in the data De novo sequencing SPIDER (de novo sequencing + homology search) DIY: –Use a mass spec to identify a protein –Use PEAKS software to determine a peptide –Use SPIDER software to identify a protein

High Performance Liquid Chromatography (HPLC) liquid (water etc.) to ESI MS/MS after 20 minutes or so

DIY: predict the retention time of a few peptides.

Protein Quantitation Several different methods for quantitation using mass spec. DIY: use a spectrum to determine the relative quantity of two proteins.

Next Generation Sequencing How to sequence an individual human’s whole genome (3G bps) in one day, using less than 1000 dollars. Huge impact on personalized medicine.