© Wiley Publishing. 2007. All Rights Reserved. RNA Analysis.

Slides:

Advertisements

Similar presentations

RNA Secondary Structure Prediction

Advertisements

Gene expression From Gene to Protein

Protein Structure and Physics. What I will talk about today… -Outline protein synthesis and explain the basic steps involved. -Go over the Chemistry of.

© Wiley Publishing All Rights Reserved. How Most People Use Bioinformatics.

TEMPLATE DESIGN © BIOINFORMATICS REFERENCES Your name and the names of the people who have contributed to this presentation.

Gene Expression and Control Part 2

MiRNA in computational biology 1 The Nobel Prize in Physiology or Medicine for 2006 Andrew Z. Fire and Craig C. Mello for their discovery of "RNA interference.

RNA Structure Prediction

Review: The flow of genetic information in the cell is DNA  RNA  protein  The sequence of codons in DNA spells out the primary structure of a polypeptide.

Predicting RNA Structure and Function. Non coding DNA (98.5% human genome) Intergenic Repetitive elements Promoters Introns mRNA untranslated region (UTR)

Predicting RNA Structure and Function

Introduction to Bioinformatics - Tutorial no. 9 RNA Secondary Structure Prediction.

Non-coding RNA William Liu CS374: Algorithms in Biology November 23, 2004.

Pattern Discovery in RNA Secondary Structure Using Affix Trees (when computer scientists meet real molecules) Giulio Pavesi& Giancarlo Mauri Dept. of Computer.

From DNA to Protein.

Predicting RNA Structure and Function. Nobel prize 1989Nobel prize 2009 Ribozyme Ribosome RNA has many biological functions The function of the RNA molecule.

Presenting: Asher Malka Supervisor: Prof. Hermona Soreq.

MicroRNA genes Ka-Lok Ng Department of Bioinformatics Asia University.

Predicting RNA Structure and Function. Following the human genome sequencing there is a high interest in RNA “Just when scientists thought they had deciphered.

. Class 5: RNA Structure Prediction. RNA types u Messenger RNA (mRNA) l Encodes protein sequences u Transfer RNA (tRNA) l Adaptor between mRNA molecules.

1 Ref: Ch. 5 Mount: Bioinformatics i.Protein synthesis: ribosomal RNA transfer RNA messenger RNA ii.Catalysis e.g. ribozymes iii.Regulatory molecules 17.1.

Predicting RNA Structure and Function

Predicting RNA Structure and Function. Nobel prize 1989 Nobel prize 2009 Ribozyme Ribosome.

© Wiley Publishing All Rights Reserved. Biological Sequences.

Copyright © The McGraw-Hill Companies, Inc. Permission required for reproduction or display. Chapter 3 Cell Structures and Their Functions Dividing Cells.

6.3 Translation: Synthesizing Proteins from mRNA

RNA and Protein Synthesis

Gene expression.

Lesson Overview 13.1 RNA.

Introduction to RNA Bioinformatics Craig L. Zirbel October 5, 2010 Based on a talk originally given by Anton Petrov.

RNA informatics Unit 12 BIOL221T: Advanced Bioinformatics for Biotechnology Irene Gabashvili, PhD.

Non-coding RNA gene finding problems. Outline Introduction RNA secondary structure prediction RNA sequence-structure alignment.

LECTURE CONNECTIONS 14 | RNA Molecules and RNA Processing © 2009 W. H. Freeman and Company.

Chapter 13.2 (Pgs ): Ribosomes and Protein Synthesis

Transcription Transcription is the synthesis of mRNA from a section of DNA. Transcription of a gene starts from a region of DNA known as the promoter.

MicroRNA Targets Prediction and Analysis. Small RNAs play important roles The Nobel Prize in Physiology or Medicine for 2006 Andrew Z. Fire and Craig.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

Transfection. What is transfection? Broadly defined, transfection is the process of artificially introducing nucleic acids (DNA or RNA) into cells, utilizing.

Genomics and Personalized Care in Health Systems Lecture 9 RNA and Protein Structure Leming Zhou, PhD School of Health and Rehabilitation Sciences Department.

Intelligent Systems for Bioinformatics Michael J. Watts

© Wiley Publishing All Rights Reserved. Protein 3D Structures.

From Structure to Function. Given a protein structure can we predict the function of a protein when we do not have a known homolog in the database ?

RNA folding & ncRNA discovery I519 Introduction to Bioinformatics, Fall, 2012.

1 RNA Bioinformatics Genes and Secondary Structure Anne Haake Rhys Price Jones & Tex Thompson.

CFE Higher Biology DNA and the Genome Translation.

How Genes Work Ch. 12.

Chapter 7 Gene Expression and Control Part 2. Transcription: DNA to RNA  The same base-pairing rules that govern DNA replication also govern transcription.

Spliceosome attachs to hnRNA and begins to snip out non-coding introns mRNA strand composed of exons is free to leave the nucleus.

MicroRNAs and Other Tiny Endogenous RNAs in C. elegans Annie Chiang JClub Ambros et al. Curr Biol 13:

Exploiting Conserved Structure for Faster Annotation of Non-Coding RNAs without loss of Accuracy Zasha Weinberg, and Walter L. Ruzzo Presented by: Jeff.

Questions?. Novel ncRNAs are abundant: Ex: miRNAs miRNAs were the second major story in 2001 (after the genome). Subsequently, many other non-coding genes.

Gene Regulation and Expression. Learning Objectives  Describe gene regulation in prokaryotes.  Explain how most eukaryotic genes are regulated.  Relate.

THE FLOW OF GENETIC INFORMATION FROM DNA TO RNA TO PROTEIN

GENETICS ESSENTIALS Concepts and Connections SECOND EDITION GENETICS ESSENTIALS Concepts and Connections SECOND EDITION Benjamin A. Pierce © 2013 W. H.

RNA Structure Prediction RNA Structure Basics The RNA ‘Rules’ Programs and Predictions BIO520 BioinformaticsJim Lund Assigned reading: Ch. 6 from Bioinformatics:

Copyright © by Holt, Rinehart and Winston. All rights reserved. ResourcesChapter menu Flow of Genetic Information The flow of genetic information can be.

Motif Search and RNA Structure Prediction Lesson 9.

Classification of real and pseudo microRNA precursors using local structure-sequence features and support vector machine 朱林娇 14S

RNA DBP: modeling and dynamics of RNA Russ Altman Vijay Pande.

Protein Synthesis. DNA mRNA DNA Cannot the nucleus Sends to the cytoplasm via Its base sequence (called a codon) determines the amino acid in proteins.

Protein Synthesis RNA, Transcription, and Translation.

RNAs. RNA Basics transfer RNA (tRNA) transfer RNA (tRNA) messenger RNA (mRNA) messenger RNA (mRNA) ribosomal RNA (rRNA) ribosomal RNA (rRNA) small interfering.

Mirela Andronescu February 22, 2005 Lab 8.3 (c) 2005 CGDN.

Lab 8.3: RNA Secondary Structure

Predicting RNA Structure and Function

RNA Secondary Structure Prediction

RNA Secondary Structure Prediction

Identification and Characterization of pre-miRNA Candidates in the C

Noncoding RNA roles in Gene Expression

Computational Genomics of Noncoding RNA Genes

Presentation transcript:

© Wiley Publishing All Rights Reserved. RNA Analysis

Learning Objectives Know the basics on RNA structures Predict the structure of your favorite RNA molecule Get an idea of the diversity of the RNA world

Outline Basic facts on RNA secondary structures Predicting secondary structures with the Mfold server Searching databases for specific RNAs Micro RNAs

RNA secondary structures RNA is made of 4 nucleotides A, G, C, U RNA molecule are single-stranded but they can interact with themselves to form secondary structures The most typical RNA secondary structure is the hairpin Hairpins are usually mad of a stem and a loop as shown here

Predicting RNA Secondary Structures It is possible to predict the secondary structure of an RNA sequence The accuracy is ~70% Predictions are easier and more accurate on small molecules (fewer than 500 nucleotides) More accurate predictions can be made using multiple-sequence alignments

Single-Sequence Structure Prediction for RNA Make single-sequence predictions using the Mfold server The server predicts the most stable secondary structure The most stable structure is the one with the lowest potential energy Mfold can also return suboptimal structures Similar optimal and suboptimal structure indicate good accuracy

Forcing Mfold If you have a known structure, you can force it into Mfold as a constraint Secondary structures can be found experimentally Mfold cannot accept pseudo-knots as constraints

The Best RNA Secondary Structure Predictions Come from MSAs The best predictions are based on multiple-sequence alignments They take advantage of covariation No online resource is yet available but you can use selab.janelia.org/software.html

Searching Databases for tRNAs Transfer RNAs are small RNA molecules used to build proteins Each protein has 64 tRNAs One for each triplet of the genetic code All tRNAs have the same structure They are easy to find in a genome tRNAscan from Sean Eddy (shown) Visit selab.janelia.org for examples

Searching Databases for RNA motifs It is possible to search databases for RNA sequences that can fold according to a specified pattern Use Patscan to search Available at www-unix.mcs.anl.gov/compbio/PatScan/

Finding RNA Genes Many genes do not code for proteins They simply code for RNA tRNA, ribosomal RNA, and miRNA (micro-RNAs) tRNA and ribosomal RNA genes are easy to find The other non-coding genes (such as miRNAs) are very difficult to find We do not know how many RNA genes are in the human genome ENSEMBL reports 3994 on release 36 of the human genome

Micro-RNAs (miRNAs) Micro-RNAs are small, non-coding RNAs involved at almost every stage of cell regulation Micro-RNAs can silence genes through RNA interference Nobel Prize 2006 : Fire and Melo for discovering RNA interference miRNAs are the future of medicine; find them at these sites: sirna.cgb.ki.se microrna.sanger.ac.uk

Going Farther RNA is the “poor cousin” of bioinformatics The NCBI has no RNA section The RNA world is receiving ever-increasing attention Many excellent public resources are available for RNA Example: