Korea BioInformation Center Byoung-Chul Kim

Slides:



Advertisements
Similar presentations
LS-SNP: Large-scale annotation of coding non- synonymous SNPs based on multiple information sources -Bioinformatics April 2005.
Advertisements

CZ5225 Methods in Computational Biology Lecture 9: Pharmacogenetics and individual variation of drug response CZ5225 Methods in Computational Biology.
Introduction to genomes & genome browsers
Beyond PubMed and BLAST: Exploring NCBI tools and databases Kate Bronstad David Flynn Alumni Medical Library.
Genome databases and webtools for genome analysis Become familiar with microbial genome databases Use some of the tools useful for analyzing genome Visit.
A Lite Introduction to (Bioinformatics and) Comparative Genomics Chris Mueller August 10, 2004.
The design, construction and use of software tools to generate, store, annotate, access and analyse data and information relating to Molecular Biology.
Outline to SNP bioinformatics lecture
Bioinformatics and the Engineering Library ASEE 2008 Amy Stout.
Predicting the Function of Single Nucleotide Polymorphisms Corey Harada Advisor: Eleazar Eskin.
Bioinformatics: a Multidisciplinary Challenge Ron Y. Pinter Dept. of Computer Science Technion March 12, 2003.
Genome Browsers Ensembl (EBI, UK) and UCSC (Santa Cruz, California)
IST Computational Biology1 Information Retrieval Biological Databases 2 Pedro Fernandes Instituto Gulbenkian de Ciência, Oeiras PT.
BI420 – Course information Web site: Instructor: Gabor Marth Teaching.
SNP Resources: Finding SNPs Databases and Data Extraction Mark J. Rieder, PhD Robert J. Livingston, PhD NIEHS Variation Workshop January 30-31, 2005.
Whole Genome Polymorphism Analysis of Regulatory Elements in Breast Cancer AAGTCGGTGATGATTGGGACTGCTCT[C/T]AACACAAGCGAGATGAAGAAACTGA Jacob Biesinger Dr.
Visualization of genomic data Genome browsers. UCSC browser Ensembl browser Others ? Survey.
CS 374: Relating the Genetic Code to Gene Expression Sandeep Chinchali.
Polymorphisms – SNP, InDel, Transposon BMI/IBGP 730 Victor Jin, Ph.D. (Slides from Dr. Kun Huang) Department of Biomedical Informatics Ohio State University.
SNP Resources: Finding SNPs Databases and Data Extraction Mark J. Rieder, PhD SeattleSNPs Variation Workshop March 20-21, 2006.
Paola CASTAGNOLI Maria FOTI Microarrays. Applicazioni nella genomica funzionale e nel genotyping DIPARTIMENTO DI BIOTECNOLOGIE E BIOSCIENZE.
Doug Brutlag Professor Emeritus Biochemistry & Medicine (by courtesy) Genome Databases Computational Molecular Biology Biochem 218 – BioMedical Informatics.
BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources Jeongheui Lim Korean BioInformation Center Korea Research.
Identifying deleterious Single Nucleotide Polymorphisms using multiple sequence alignments CMSC858P Project by Maya Zuhl.
Computational Molecular Biology Biochem 218 – BioMedical Informatics Simple Nucleotide.
Overview of Bioinformatics A/P Shoba Ranganathan Justin Choo National University of Singapore A Tutorial on Bioinformatics.
>>> Korean BioInformation Center >>> KRIBB Korea Research institute of Bioscience and Biotechnology GS2PATH: Linking Gene Ontology and Pathways Jin Ok.
24 August 2015 · 1ISCB Student Council · ISCB Student Council and the Regional Student Group Korea Sungsoo Kang & Joshua Yang Korean.
Gene Structure and Identification
Cooperative Initiatives in Bioinformatics for the East Asia Region By Jong KOBIC (Korean Bioinformation Center) KRIBB KOREA
GeVab: Genome Variation Analysis Browsing Server Korean BioInformation Center, KRIBB InCoB2009 KRIBB
Presented by: Andrew McMurry Boston University Bioinformatics Children’s Hospital Informatics Program Harvard Medical School Center for BioMedical Informatics.
Databases in Bioinformatics and Systems Biology Carsten O. Daub Omics Science Center RIKEN, Japan May 2008.
PutidaNET :Interactome database service and network analysis of Pseudomonas putida KT2440 (P. putida KT2440) Korean BioInformation Center (KOBIC) Seong-Jin,
A systems biology approach to the identification and analysis of transcriptional regulatory networks in osteocytes Angela K. Dean, Stephen E. Harris, Jianhua.
01/03/2013UK NEQAS UV Participants Meeting 2013 in a quality perspective.
Doug Brutlag 2011 Genomics & Medicine Doug Brutlag Professor Emeritus of Biochemistry &
GENOME-CENTRIC DATABASES Daniel Svozil. NCBI Gene Search for DUT gene in human.
UCSC Genome Browser 1. The Progress 2 Database and Tool Explosion : 230 databases and tools 1996 : first annual compilation of databases and tools.
A Lite Introduction to (Bioinformatics and) Comparative Genomics Chris Mueller November 18, 2004 Based on the Genomics in Biomedical Research course at.
Bioinformatics. Sequence information Mapping information Phenotypic information Literature Prediction programs -Gene prediction -Promotor prediction -Functional.
COURSE OF BIOINFORMATICS Exam_31/01/2014 A.
DNA TECHNOLOGY AND BIOTECHNOLOGY PAGES Chapter 10.
Sample to Insight Alexander Kaplun, PhD Sep PGMD: a comprehensive pharmacogenomic database for personalized medicine and drug discovery.
Sackler Medical School
Gene Regulatory Networks and Neurodegenerative Diseases Anne Chiaramello, Ph.D Associate Professor George Washington University Medical Center Department.
Biological Networks & Systems Anne R. Haake Rhys Price Jones.
MitoVariome: A variome database of human mitochondrial DNA
Epidemiology 217 Molecular and Genetic Epidemiology Bioinformatics & Proteomics John Witte.
Bioinformatics and Computational Biology
Genes and Genomes. Genome On Line Database (GOLD) 243 Published complete genomes 536 Prokaryotic ongoing genomes 434 Eukaryotic ongoing genomes December.
Diving into the gene pool: Chromosomes, genes and DNA
The Future of Genetics Research Lesson 7. Human Genome Project 13 year project to sequence human genome and other species (fruit fly, mice yeast, nematodes,
UCSC Genome Browser Zeevik Melamed & Dror Hollander Gil Ast Lab Sackler Medical School.
COMUS : Clinician-Oriented locus-specific MUtation detection and deposition System Korean BioInformation Center (KOBIC) Sungwoong Jho 8 th InCoB September.
Single Nucleotide Polymorphisms (SNPs) By Amira Jhelum Rahul Shweta.
Using public resources to understand associations Dr Luke Jostins Wellcome Trust Advanced Courses; Genomic Epidemiology in Africa, 21 st – 26 th June 2015.
Different microarray applications Rita Holdhus Introduction to microarrays September 2010 microarray.no Aim of lecture: To get some basic knowledge about.
The regulation of Caspase 8 chIP-seq motifs mRNA expression DNA methylation.
Week-6: Genomics Browsers
SynechoNET: integrated protein interaction database of Synechocystis
Visualization of genomic data
Genomes and Their Evolution
Genome organization and Bioinformatics
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Ensembl Genome Repository.
KEY CONCEPT Entire genomes are sequenced, studied, and compared.
Biological Databases BI420 – Introduction to Bioinformatics
Gene Safari (Biological Databases)
SNPs and CNPs By: David Wendel.
Presentation transcript:

Korea BioInformation Center Byoung-Chul Kim SNP@Promoter : A database of Human SNPs (Single Nucleotide Polymorphisms) within putative promoter region Korea BioInformation Center Byoung-Chul Kim

Korean Bioinformation Center (KOBIC) The national bioinformatics center of Korea Mission is to integrate of diverse biological information Genome information Biodiversity information Bioresource information Work towards the development of international training programs on bioinformatics Develop bioinformatics tools and resources which need your participation BioWiki (online knowledgebase of biology) BioPipe (Bioworkflow engine) 2

BioWiki Wiki a web technology that enables anyone to create and update website contents. well suited for developing online knowledge bases (e.g., Wikipedia ). BioWiki Project that in order to adopt the wiki paradigm in biology Goal is the collaborative development of biological knowledge bases. BioWiki Contest ( http://biowiki.net ) 3

BioPipe To participate in, please visit. http://www.biopipe.net Design View Ontology View Monitoring View Toolbar Drag the module from the list and drop it into the design view. BioWorkFlow Engine Design of bioinformatics pipelines No installation required Drag, Drop and Connect Biopipe Contest - openfree Web 2.0 - period : Aug 15th ~ Sep 20th To participate in, please visit. http://www.biopipe.net 4

Korea BioInformation Center Byoung-Chul Kim SNP@Promoter : A database of Human SNPs (Single Nucleotide Polymorphisms) within putative promoter region Korea BioInformation Center Byoung-Chul Kim

What are SNPs (Single Nucleotide Polymorphisms) Common DNA sequence variations among individuals in genome wherein the least frequent allele has an abundance of 1% or greater. Make up about 90% of all human genetic variation Occurs every 100 to 300 bases along the 3-billion-bases human genome Some SNPs are reported to be highly related to diseases or influence cells response to a drug

SNPs have various functions G/T promoter G/T G/C GU AG TFBS 5’UTR atggacgtactggtg tctgagtgctccgcg 3’UTR A/G G/T Type 1 transcript Type 2 transcript Type 3 transcript Type 1 protein M D V L V S E C S A Altering the encoded protein Alternative splicing Premature termination Transcription regulation M D V L V S E S S A Type 2 protein Type 3 protein

KOBIC Variome Project Http://variome.net

SNP@Promoter is constructed such as… Identification of putative promoter regions NCBI Entez Genes NCBI Human Genome Transfac Prediction of Transcription factor binding sites NCBI dbSNP SNPs within regulatory region UCSC human conservation score Calculation of Evolution conservation score in TFBS KEGG HGMD OMIM GAD GOA Integration of Functional annotation databases

We can improve the predictive sensitivity of TFBS Prediction of TFBS have high false-positive rate Evolutionarily conserved regions within or adjoining the gene often serve as critical cis-regulatory regions SNP@Promoter show the predicted TFBS with evolutionary conservation score UCSC GENOME BROWSER

What can you do with SNP@Promoter? Gene Predicted TFBS Ontology Conservation of TFBS Pathway Annotation SNP within Promoter SNP within TFBS GAD GOA OMIM UCSC Disease association KEGG NCBI dbSNP Transfac HGMD Human Genome NCBI Gene

Example : Atopy associated genes and SNPs

Atopy associated gene list

SNPs in atopy associated gene

Graphic viewer

Conclusions http://variome.kobic.re.kr SNP@promoter is a database Predict functional SNPs Provide a platform for biologists for finding functional SNPs http://variome.kobic.re.kr http://variome.kobic.re.kr/SNPatPromoter/