1. BI420 – Course information Web site: http://bioinformatics.bc.edu/~marth/BI420http://bioinformatics.bc.edu/~marth/BI420 Instructor: Gabor Marth Teaching assistant: Aaron Quinlan

2. BI420 – Material Lectures (PowerPoints posted on web site) Text

3. BI420 – Discovery questions http://www.aw-bc.com/geneticsplace/

4. BI420 – Discovery questions Page 36, Discovery question #1.

5. BI420 – Discovery questions GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT

6. BI420 – Discovery questions

8. Genome organization and Bioinformatics Gabor T. Marth Department of Biology, Boston College marth@bc.edu BI420 – Introduction to Bioinformatics

9. The animal cell

10. DNA – the carrier of the genetic code

11. DNA organization – chromosomes

12. DNA organization – mitochondria

13. Translation of genetic information

14. Gene organization

15. mRNA splicing – alternative splicing

16. Gene expression

17. Protein structure

18. RNA structure

19. DNA evolution

20. Mechanisms of molecular evolution

21. Evolution of chromosome organization

22. Evolution of gene structure

23. Evolution of DNA sequence

24. Genetic variations

25. 1. The informatics of DNA sequencing DNA sequencing informatics

26. 2. Gene prediction, genome annotation

27. 3. Polymorphism discovery and analysis look at multiple sequences from the same genome region use base quality values to decide if mismatches are true polymorphisms or sequencing errors

28. 4. Gene/DNA expression analysis

29. 5. Proteomics

30. 6. Storage/retrieval of Biological data

31. 7. Sequence alignment/similarity search

32. 8. Phylogenetics

33. 9. Evolutionary Genomics

34. 10. Medical Genomics

35. 11. Practical Bioinformatics using LINUX programming in PERL

36. 12. Practical Bioinformatics HIT idcloneIDhspIDstartend 111117957 22196912114891 CLONE id name received masked 1NH0260K0812-25-9912-26-99 2NH0407F0212-28-9901-03-00 ALLELE id hitID nucleotide 11C 22T using and building databases