Next Semester Classes Planning. Previous bioinformatics class  They can give you an idea about the difficulty level and interestingness factor.

Slides:

Advertisements

Similar presentations

Using bioinformatics for better understanding of genes Becky Seipelt Karla Marriott Arlin Toro Vilma Martinez Roger Lui

Advertisements

CSE 5522: Survey of Artificial Intelligence II: Advanced Techniques Instructor: Alan Ritter TA: Fan Yang.

Introduction BNFO 602 Usman Roshan. Course grade Project: –Find a bioinformatics topic by Feb 5th. This can be a paper or a research question you wish.

BIOINFORMATICS Ency Lee.

SYMMETRIC CRYPTOSYSTEMS Symmetric Cryptosystems 10/06/2015 | pag. 2.

Southern California Bioinformatics Summer Institute Wendie Johnston, Beverly Krilowicz, Jamil Momand, Sandra Sharp, Nancy Warter- Perez.

. Class 1: Introduction. The Tree of Life Source: Alberts et al.

Introduction to Bioinformatics Spring 2008 Yana Kortsarts, Computer Science Department Bob Morris, Biology Department.

Introduction to Genomics, Bioinformatics & Proteomics Brian Rybarczyk, PhD PMABS Department of Biology University of North Carolina Chapel Hill.

BI420 – Course information Web site: Instructor: Gabor Marth Teaching.

Bioinformatics in the Biology Curriculum Gloria Rendon NCSA July 2008.

The Central Dogma of Molecular Biology (Things are not really this simple) Genetic information is stored in our DNA (~ 3 billion bp) The DNA of a.

Cbio course, spring 2005, Hebrew University Computational Methods In Molecular Biology CS-67693, Spring 2005 School of Computer Science & Engineering Hebrew.

Discrete Structures for Computer Science Ruoming Jin MW 5:30 – 6:45pm Fall 2009 rm MSB115.

Fall 2010/Lecture 311 CS 426 (Fall 2010) Public Key Encryption and Digital Signatures.

CSE 590ST Statistical Methods in Computer Science Instructor: Pedro Domingos.

Incorporating Bioinformatics in an Algorithms Course Lawrence D’Antonio Ramapo College of New Jersey.

CISC667, F05, Lec27, Liao1 CISC 667 Intro to Bioinformatics (Fall 2005) Review Session.

Welcome to Introduction to Bioinformatics Computing aka BIC1.

Ayesha Masrur Khan Spring Course Outline Introduction to Bioinformatics Definition of Bioinformatics and Related Fields Earliest Bioinformatics.

EECS 395/495 Algorithmic Techniques for Bioinformatics General Introduction 9/27/2012 Ming-Yang Kao 19/27/2012.

CSE 515 Statistical Methods in Computer Science Instructor: Pedro Domingos.

Data and Text Mining for Computational Biology Introduction.

341: Introduction to Bioinformatics Dr. Natasa Przulj Deaprtment of Computing Imperial College London

1 CSE 5351: Introduction to Cryptography Ten H. Lai Spring 2015 MW 3:55-5:15 PM, CL133.

Block and Stream Ciphers1 Reference –Matt Bishop, Computer Security, Addison Wesley, 2003.

Teaching Teaching Discrete Mathematics and Algorithms & Data Structures Online G.MirkowskaPJIIT.

Cryptography Lecture 1: Introduction Piotr Faliszewski.

Bioinformatics.

C OMPUTATIONAL BIOLOGY. O UTLINE Proteins DNA RNA Genetics and evolution The Sequence Matching Problem RNA Sequence Matching Complexity of the Algorithms.

Bioinformatics Sean Langford, Larry Hale. What is it?  Bioinformatics is a scientific field involving many disciplines that focuses on the development.

Bioinformatics Timothy Ketcham Union College Gradutate Seminar 2003 Bioinformatics.

1 Bio + Informatics AAACTGCTGACCGGTAACTGAGGCCTGCCTGCAATTGCTTAACTTGGC An Overview پرتال پرتال بيوانفورماتيك ايرانيان.

A Bridge to Bioinformatics Tools Introducing Programming in Genetics Classes Ogun Adebali, Ed Himelblau, Ioannis Tsiligaridis.

Welcome to Introduction to Bioinformatics Computing aka BIC1.

CS 483 – SD SECTION BY DR. DANIYAL ALGHAZZAWI (1) Information Security.

CS461: Principles and Internals of Database Systems Instructor: Ying Cai Department of Computer Science Iowa State University Office:

Master’s Degrees in Bioinformatics in Switzerland: Past, present and near future Patricia M. Palagi Swiss Institute of Bioinformatics.

Machine Learning Lecture 1. Course Information Text book “Introduction to Machine Learning” by Ethem Alpaydin, MIT Press. Reference book “Data Mining.

CS397-CXZ Algorithms in Bioinformatics ChengXiang (“Cheng”) Zhai, Robert Skeel (Department of Computer Science) Nick Sahinidis (Department of Chemical.

Intelligent systems in bioinformatics Introduction to the course.

CSCI 6900/4900 Special Topics in Computer Science Automata and Formal Grammars for Bioinformatics Bioinformatics problems sequence comparison pattern/structure.

CSC 170 Computing: Science and Creativity

Introduction to Bioinformatics Biostatistics & Medical Informatics 576 Computer Sciences 576 Fall 2008 Colin Dewey Dept. of Biostatistics & Medical Informatics.

CS 456 Advanced Algorithms Where: Engineering Bldg When: Monday & Wednesday 12:00 – 1:15 p.m. Texts: Algorithm Design, Jon Kleinberg & Eva Tardos.

Overview of Bioinformatics 1 Module Denis Manley..

Introduction to Bioinformatics Dr. Rybarczyk, PhD University of North Carolina-Chapel Hill

AdvancedBioinformatics Biostatistics & Medical Informatics 776 Computer Sciences 776 Spring 2002 Mark Craven Dept. of Biostatistics & Medical Informatics.

Evolution of BINF Bioinformatics Certificate Foothill College R. Cormia, L. English, K. Erickson.

15-499Page 1 Course Course: Algorithms and Applications (15-499) Instructor Instructor: Guy Blelloch TA TA: Shuchi Chawla URL URL:

Proposal for Term Project Information Security, Fall 2014 J. H. Wang Sep. 25, 2014.

BIOLOGICAL DATABASES. BIOLOGICAL DATA Bioinformatics is the science of Storing, Extracting, Organizing, Analyzing, and Interpreting information in biological.

Central dogma: the story of life RNA DNA Protein.

EB3233 Bioinformatics Introduction to Bioinformatics.

Bioinformatics Curriculum Issues, goals, curriculum.

Algorithms for Biological Sequence Analysis Kun-Mao Chao ( 趙坤茂 ) Department of Computer Science and Information Engineering National Taiwan University,

Course web page: ECE 646 Cryptography and Computer Network Security ECE web page  Courses  Course web pages  ECE 646.

CS 483 – SD SECTION BY DR. DANIYAL ALGHAZZAWI (2) Information Security.

CMPT 308 — Computability and Complexity Fall 2004 Instructor: Andrei Bulatov, TA: Ramsay Dyer, Learning.

CS177 week 3 scavenger hunt team mini-project start in class finish as part of homework this will include a mixture of things we have and have not covered.

Proposal for Term Project Information Security, Fall 2013 J. H. Wang Nov. 5, 2013.

BNFO 615 Fall 2016 Usman Roshan NJIT. Outline Machine learning for bioinformatics – Basic machine learning algorithms – Applications to bioinformatics.

S5.40. Module Structure 30% practical tests / 70% written exam 3h lectures / week (except reading week) 3 x 2h of computer labs (solving problems practicing.

CS140 – Computer Programming 1 Course Overview First Semester – Fall /1438 – 2016/2017 CS140 - Computer Programming 11.

Bioinformatics Overview

Introduction to Bioinformatics and Functional Genomics

Syllabus Introduction to Computer Science

Predict Protein Sequence by Fuzzy-Association Rules

KEY CONCEPT Entire genomes are sequenced, studied, and compared.

Introduction to Bioinformatics

Presentation transcript:

Next Semester Classes Planning

Previous bioinformatics class  They can give you an idea about the difficulty level and interestingness factor

Fall: 2010 Course NumberCourseInstructor 281 ArchitectureAdjunct 332 AlgorithmsRosulek 344 Operating SystemsRaiford 415 Computers, Ethics, SocietyReimer 441 Advanced Programming: Theory and Practice IChen 457 Artificial IntelligenceWright 458 BioinformaticsRaiford 495 CryptoRosulek 565 Advanced DatabaseChen 595 Advanced AlgorithmsRosulek

Bioinformatics  Introduced to Bioinformatics  Learn Perl  Write the code for  A hierarchical clustering algorithm  A recursive genetic alignment algorithm  Get a gentle introduction to Hidden Markov Models  Implement in Matlab  Get a gentle introduction to Principal Components Analysis  Use in Matlab to analyze multidimensional data

Bioinformatics  Introduction to molecular biology and the central dogma.  Current technologies used in sequencing genomes  Introduction to Perl, using Perl in sequence handling.  How to search for similar sequences in large sequence databases, and why such searches are so important in biological and medical research.  Phylogeny: what it is and why is it important  Prediction of RNA and protein secondary structure  Protein analysis and structure prediction  Forensic DNA analysis

CS 495/595: Cryptography [Info]  What is crypto? Leveraging computation to…  … make things easy for the good guys  … make things nearly impossible for the bad guys  Instructor: Mike Rosulek  Prereqs:  Math 225 or 305  CS 332 recommended  Programming fluency  Homeworks: Mixture of math, implementation, problem- solving, computation/number-crunching

CS 495/595: Cryptography [Topics] Breaking “classical” ciphers: Caesar, Vigenère, newspaper “cryptogram” Theory of classical encryption: Why one-time pads are necessary “Modern” block ciphers (AES, DES) How to design good ones, how to break bad ones The public-key revolution (RSA, Diffie-Hellman) Crypto from hard problems in number theory Beyond encryption: A look into the future!

Other Courses  Artificial Intelligence: Classic problems and approaches  Crypto: computational complexity used to confound would be evesdroppers  Advanced Database: Normal forms, relational algebra, maybe some data mining  Advanced Algorithms: Algorithm design, …Complexity theory: NP-hard and NP-complete problems. Approximation algorithms for intractable problems

Finals: need to make a decision Meeting time during semester Final Exam TimeDay 12:108:00-10:00Wednesday, May 12 1:101:10-3:10Monday, May 10  Go to registrar’s site:  Click on “students” (right below registrar’s office banner)  Click on finals week schedule.  Since we meet at 12:40 have a choice between