Cédric Notredame (30/08/2015) Chemoinformatics And Bioinformatics Cédric Notredame Molecular Biology Bioinformatics Chemoinformatics Chemistry

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics ChemoinformaticsBioinformatics Sequences (Structures) Ligands/Lead Genes Genomes Drugs Scale Proteins

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics ChemoinformaticsBioinformatics Sequences (Structures) Ligands Chain Each Atom AGCTGTCGAGGGATAGGACA TATACATAAATTAATATAAT Describing the DATA Strings SMILES, Sybyl, Matrices… Structure Descriptors Chain Atom 3D-Structure

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics ChemoinformaticsBioinformatics Sequences (Structures) Ligands Chain Each Atom AGCTGTCGAGGGATAGGACA TATACATAAATTAATATAAT Storing the DATA Strings SMILES, Sybyl, Matrices, descriptors Chain Atom 3D-Structure Sequence Chemical Structure Coordinates PDB GenBank: Genomes Genpep/NR: proteins SwissProt CAPLUS REGISTRY …

Cédric Notredame (30/08/2015) Related Techniques Databases Bioinformatics: NCBI/EBI Chemoinformatics CAS/Beilstein/MDL Finding the right Database is NOT an issue as most data are public.

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics ChemoinformaticsBioinformatics Sequences (Structures) Ligands SimilarityDescriptor Comparing the DATA Evolutionary modelDescriptor Similarity Fold 3D-Model Dynamic Programming Structure/Structure Comparison Backtracking Algorithm BLAST LSQman DALI SAP CACTUS (Cactus.nci.nih.gov)

Cédric Notredame (30/08/2015) Related Techniques Searching Databases Bioinformatics: Dynamic Programming Chemoinformatics Backtracking

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics ChemoinformaticsBioinformatics Sequences (Structures) Ligands MSADescriptor Building Models Multiple Sequence Alignments ClustalW, TCoffee Descriptor Computation Fold 3D-Model Classifications DALI SCOP CAT

Cédric Notredame (30/08/2015) Related Techniques Profiles Bioinformatics: Chemoinformatics

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics ChemoinformaticsBioinformatics Sequences (Structures) Ligands FunctionDescriptor Predicting Properties Multiple Comparisons QSAR Binding Docking/Mecanisms Structure Phylogeny Molecular Dynamic Docking Predictions Function Relate descriptors to Activity/Toxicity Profiles Pfam

Cédric Notredame (30/08/2015) Related Techniques Profiles and Descriptors Bioinformatics: Chemoinformatics Database Search With a Profile Pharmacophore Database Search With a Profile

Cédric Notredame (30/08/2015) Bioinformatics/ Chemoinformatics Each One in its Niche

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics The Questions Bioinformatics: Target Chemoinformatics Lead Target Site Compound Database

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics The Questions Evolutionary Trace Chemical Modelling

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics The Questions Bioinformatics: Function Chemoinformatics QSAR Comparative Genomics Function Quantitative Structure-Activity Relationship Activity/Toxicity

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics The Questions Bioinformatics: Target Chemoinformatics Lead Comparative Genomics Molecular Dynamic Docking 2D/3D QSAR Molecular Dynamic In Silico Screening

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics The Algorithms Bioinformatics: Target Chemoinformatics Lead Dynamic Programming Backtrace Graph Theory Neural Networks Genetic Algorithms Hidden Markov Models

Cédric Notredame (30/08/2015) Bioinformatics/ Chemoinformatics Where Do They Meet

Cédric Notredame (30/08/2015) Homology based SAR predictions

Cédric Notredame (30/08/2015) SAR Matrices contain affinity Data Homology based SAR predictions

Cédric Notredame (30/08/2015) Targets can be clustered from the SAR Data Homology based SAR predictions

Cédric Notredame (30/08/2015) Targets can be clustered using similarity Homology based SAR predictions

Cédric Notredame (30/08/2015) Sequence Clustering Can be done using Key positions Homology based SAR predictions

Cédric Notredame (30/08/2015) Sequence Clustering Can be done using Key positions Homology based SAR predictions

Cédric Notredame (30/08/2015) Does it Work ??? –Clustering Based on Active Site Residues Homology based SAR predictions

Cédric Notredame (30/08/2015) Homology based SAR predictions –Pairs of Comparable Kinases

Cédric Notredame (30/08/2015) Bioinformatics/ Chemoinformatics Main Differences ?

Cédric Notredame (30/08/2015) Bioinformatics and Chemoinformatics Bioinformatics: Chemoinformatics Macro-molecules Small Molecules Evolutionary Signal Chemical Modelling