DNA Technology A.P. Biology Biotech Intro Glowing Fish Glowing Mouse Mistake

What’s Next – Google Brain?

Uses of DNA Technology Find out what genes do (mutate or knock out a developmental gene and see what happens) Make large amounts of a protein In-situ hybridization – can tell if an embryo has a defective gene Diagnosis, treatment, prevention of disease Study of relatedness of species Crime Solving

DNA Technology Uses Continued Study gene expression Study growth and differentiation Identify recessive alleles Vaccines (make large amounts of proteins that trigger the immune response Designer Drugs (anti-fat drugs) RNAi (blocks translation – find out what a gene does) Gene Therapy (put genes in somatic or germ cells) Problems: How do you introduce it? How do you control gene expression How do you get the gene product where it’s needed May alter other cell functions Eugenics are a worry (controlling the genetic make-up)

Technology #1 – Gene Cloning Making multiple copies of a gene by putting it in a cell that will replicate it and pass it on to offspring Although you can make lots of copies of a gene in a tt, it will actually produce the protein if in a cell To clone a gene you will need: restriction enzymes, a vector, and a host cell

Restriction Enzymes naturally used by bacteria to digest foreign DNA Bacteria methylates its DNA (A&C) to protect itself since methylation prevents DNA digestion Can buy and use to cut and insert foreign DNA Cut at palindromic sequences – same forward and back (same 5’-3’ or vice versa)

Enzyme Organism from which derived Target sequence (cut at *) 5' -->3' Ava I Anabaena variabilis C* C/T C G A/G G Bam HI Bacillus amyloliquefaciens G* G A T C C Bgl II Bacillus globigii A* G A T C T Eco RI Escherichia coli RY 13 G* A A T T C Eco RII Escherichia coli R245 * C C A/T G G Hae III Haemophilus aegyptius G G * C C Hha I Haemophilus haemolyticus G C G * C Hind III Haemophilus inflenzae Rd A* A G C T T Hpa I Haemophilus parainflenzae G T T * A A C Kpn I Klebsiella pneumoniae G G T A C * C Mbo I Moraxella bovis *G A T C Pst I Providencia stuartii C T G C A * G Sma I Serratia marcescens C C C * G G G SstI Streptomyces stanford G A G C T * C Sal I Streptomyces albus G G * T C G A C Taq I Thermophilus aquaticus T * C G A Xma I Xanthamonas malvacearum C * C C G G G

Cloning Vectors Something to carry gene so it gets copied a. Phages (as the phage replicates inside the bacteria so does the added gene and it spreads to other bacteria) – holds up to 25kb of DNA b. Plasmids – as bacteria reproduce – clones gene within the colony – holds up to 12 kb c. Retroviruses – have advantage that they can incorporate into the host chromosome in animal cells – Can hold 8-10kb Yeast artificial chromosomes (YAC’s) – a “fake” chromosome containing foreign DNA with the ability to replicate and undergo mitosis – up to 3000kb e. Bacterial Artificial Chromosomes (BAC’s) – a fake bacterial chromosome – can hold 100-300 kb

Example of Plasmid

Advantages of Plasmids as Vectors Replicate quickly Has an origin of replication so is copied and passes to daughter cells Doesn’t need to enter genome to be copied Easy to put DNA into plasmids Easy to put plasmids into bacteria Can incorporate selection factors to make it easy to find bacteria containing gene of interest

Host Can use animal cell, plant cell, yeast cell, or bacteria Host Can use animal cell, plant cell, yeast cell, or bacteria. Bacteria are the easiest – can get DNA in to the cell easier and they replicate faster a. Difficult to put DNA into eukaryotic cells (can electroporate, inject the DNA, or attach the DNA to metal beads and shoot through membrane with a gun) – usually use retroviruses! b. Although bacteria are easy to use, you can’t always use them because they don’t have mechanisms to cut out introns and don’t do post- translational modifications – if it needs these modifications to be functional, must use a eukaryotic cell

Making Recombinant DNA: How do you clone a gene and how do find the cells that have your gene in them? 1. Cut out your gene of interest and put it in a vector Digest the plasmid and DNA of interest with same restriction enzyme (now have compatible sticky ends) Some plasmids will close up without gene Some plasmids will get the gene inserted

How to Clone a Gene Continued 2. Transforming Bacteria (putting the gene of interest with the plasmid into the cell) Artificial Transformation Need competent cells (in exponential growth) Positive ions make cell membranes permeable to DNA Can also use electroporation, heat shock Can inject the DNA

Gene Cloning Continued 3. Selecting cells that have the gene of interest Need to know if the gene is inserted into the plasmid and if the plasmid is inserted into the cell A. To see if colony has the plasmid - Use a plasmid that has antibiotic resistance gene – if plasmid is inserted, it will grow on antibiotic (like ampr – and grow on amp) To see if plasmid containing colonies have plasmids with the gene of interest: Use restriction enzymes that cuts in the middle of a color gene like the β galactosidase gene – if inserted the colonies will be white

Selection of cells with gene of interest continued Look for protein products by activity or antibodies Make probes (short pieces of DNA or RNA that will hybridize (base pair) with the gene of interest – must be radioactive or fluorescent. Transfer some cells from each colony to filter paper, probe, and then match up colonies

Technology #2 – Creating a Genomic Library Cut whole genome with restriction enzymes – makes sticky ends Cut plasmids with same restriction enzyme to make matching sticky Mix the 2 together to get a bunch of plasmids – each with a piece of the genome Problems with Genomic Libraries There are many random fragments Must find the correct gene out of all of the plasmids Contains introns that bacteria can’t transcribe

Making a Genomic Library Use same restriction enzyme to cut genomic DNA and plasmids to make matching sticky ends

Technology #3: Creating a cDNA Library Create the cDNA (complementary DNA) Collect all of the mRNA from a cell Use the enzyme reverse transcriptase (from retroviruses) to copy the mRNA into ds DNA Cut cDNA with restriction enzymes, cut plasmids with same r.e. and mix together

PCR – polymerase chain reaction Make millions of copies of a single piece of DNA due to primers (must know some sequences flanking the gene) No need to isolate the gene first DNA can be old and in very small quantities Can use for crime detection if only have 1 cell or a small sample Can use to amplify a gene of interest before making a library so there is a higher concentration of that gene in the library

PCR Make primers complementary to the ends of the target sequence Heat denature the DNA (960) Cool DNA – primers stick (500) Heat a little and let DNA polymerase copy the ds DNA (720) Heat denature again Cool Copy, repeat, repeat, repeat 30 cycle makes 200 million copies

RT PCR Conversion of mRNA to cDNA by Reverse Transcription AAAAA Oligo dT primer is bound to mRNA RT TTTTT Reverse transcriptase (RT) copies first cDNA strand AAAAA TTTTT RT Reverse transcriptase digests and displaces mRNA and copies second strand of cDNA RT AAAAA TTTTT Double strand cDNA Conversion of mRNA to cDNA by Reverse Transcription

50º 96º 50º 72º A. Double strand DNA B. Denature C. Anneal primers Taq D. Polymerase binds 72º Taq

First round of cDNA synthesis (4 strands) Taq 72º Taq E. Copy strands Taq Taq 1 2 3 4 F. Denature 96º First round of cDNA synthesis (4 strands)

Electrophoresis – Separation of molecules based on electrical charge and size Uses: Determine the size of a fragment Purify plasmids Identify genes through hybridization/ Diagnosis of genetic disease Sequencing of a gene RFLP or VNTR analysis Paternity testing Forensics Chromosome mapping

How to pour, load, and run a gel DNA Electrophoresis Cut up DNA with restriction enzymes Load solution of cut up DNA into a well of an agarose gel (porous gel that acts as a sieve) Apply an electrical current to gel DNA is negatively charged so it moves to the positive pole. Since the gel is porous – the smaller the piece of DNA – the faster it moves so it separates by size How to pour, load, and run a gel

Electrophoresis after restriction digestion TATCTGGAAGTGGTACC GGAATCTACCGG TATCCGGAAGTGATACCGGAATCTACCGG TATCCGGAAGTGGTATCGGAATCTACCGG

Plasmid Purification What a cut vs. uncut plasmid looks like Circular forms of DNA migrate in agarose distinctly differently from linear DNAs of the same mass. Typically uncut plasmids will appear to migrate more rapidly than the same plasmid when linearized. Additionally, most preparations of uncut plasmid contain at least two topologically-different forms of DNA, corresponding to supercoiled forms and nicked circles. The image to the right shows an ethidium-stained gel with uncut plasmid in the left lane and the same plasmid linearized at a single site in the right lane.

Gene Identification If the DNA is purified Cut the DNA Run gel (DNA runs toward the + pole) Stain if have purified gene CCG↓CGGTAGGAAC CCACGGTAGGAAC ____

Gene Identification Using Genomic DNA Cut the DNA Run gel (DNA runs toward the + pole) If stained the gel – big smear of DNA because so many bands Southern Blot and Probe Probe = ATCCTT CCG↓CGGTAGGAAC CCACGGTAGGAAC ____

Southern Blotting Denature DNA in gel Transfer to Nitrocellulose paper by capillary action Probe with labeled probes Wash non-specific probe off of paper Expose to film Can see if a DNA sequence is there, how many fragments, size of fragments

Stain vs. Southern Blot with Genomic DNA

Bacterial DNA Cut with a Restriction Enzyme Left is stained/ Right is Blotted and Probed

Other Blotting Techniques Northern – same but using RNA instead of DNA Western Blotting – electrical transfer of proteins to paper and then using fluorescently or radioactively tagged antibodies to identify protein

Alternative for Genetic Disease Diagnosis Can diagnose diseases without gels using RT-PCR Collect cells – do PCR of a particular gene Sequence the gene to see if it is normal or mutated Aside – can find presence of infectious viruses this way – collect blood or cells and PCR viral genes – run on gel or sequence to see if present

RFLP or STR – Paternity Testing and DNA Fingerprinting RFLP – restriction fragment length polymorphisms Same as a Southern Blot but usually probe for non-coding regions of DNA that are highly variable (usually these regions are more variable than actual genes) Usually use multiple probes STR (short tandem repeats) Found to be the most variable among humans – makes fragments of different sizes if different number of repeats in satellite DNA

DNA Fingerprinting Must do stats for each probe – what is the % of people that carry each restriction pattern for that probe The more probes, the more sure you can be that the pattern fits only one person 6 probes is very good Probe 1 – 1/10 exhibit this pattern Probe 2 – 1/20 Probe 3 – 1/100 Probe 4 – 1/10 Probe 5 – 1/50 Probe 6 – 1/5 What is the chance that this profile can belong to another person? 1/50,000,000

Combined DNA Index System Run by the FBI Has over 5 million convicted offender DNA profiles Mandatory to have DNA profile in CODIS if involved in a homicide or sex crime Uses 13 different loci to look at 13 different areas for differences in their STR Creates a unique pattern – 1 in 10 billion have matching pattern

Paternity Testing Run standard RFLP analysis using 3-4 probes The child gets 2 copies of every gene – 1 from each parent Every allele the child has, must come from the mother or father Alleged fathers can be excluded but many times if the pattern matches – there is only a 99% chance that he is the father Usually about 1/100 people have that same pattern

Sequencing – Sanger Method Cut DNA with restriction enzymes Divide into 4 reaction tubes with all the stuff for replication – (DNA polymerase, ligase, triphosphate nucleotides) Add ddATP to 1 tube, ddTTP to 1 tube, ddGTP to 1 tube, ddCTP to another tube As DNA copies, eventually each nucleotide will be “labeled” Longest fragments at top, smallest at bottom, read from the bottom up Can do in one tube with fluorescently labeled ddnucleotides – A,T,G,C a different color

Instruments for Sequencing

New Instruments

Microarray Analysis Gives the ability to compare gene expression between: Different tissues Different species Different stages of development Cancer vs. non-cancer Healthy vs. diseased tissue Procedure: Make the microarray plate (a robot attaches single stranded pieces of DNA to a glass plate including every gene in the genome) Make cDNA from all mRNA in each of the two cell types you want to compare Make the cDNA ss and attach a red tag to the cDNA from one cell type and a green tag to the cDNA from the other cell type Add the tagged cDNA’s to the plate and let them hybridize If the spot on the plate is red – it is only expressed in that cell type, if it is green – only expressed in the other cell type, yellow – expressed in both (can even tell concentration differences)

Affix ss genes to glass plate Represents all genes of genome A scanner reads the amount of red fluorescence and green fluorescence separately so you can even tell slight differences in gene expression between the two samples

In-Vitro Mutagenesis and Transgenics Try to get a handle on the function of the gene Can change a gene and put it in a cell and see the effect on the cell Can mutate a gene in an embryonic cell and have it try to develop and see what happens in development or in adulthood

Cloning of Organisms Destroy DNA in egg Put DNA from an adult somatic cell into the egg Put the egg into a female host uterus and develop into a new organism Most are messed up, develop diseases, or die prematurely Using DNA with epigenetics (methylation, acetylation patterns) of an adult cell – not of an embryo – affects gene expression! Embryo farms – grow balls of cells that are clones to use for stem cells to grow new parts – ethical?????

Stem Cell Research Pluripotent embryonic stem cells can become any kind of cell Adult stem cells become a particular kind of cell or one of a few kinds of cells Working on taking normal differentiated cells and turning them back into stem cells so can use them to make different kinds of cells (ex. Skin becomes stem cell becomes a neuron) Ethical issues? – where are we getting them from? Found some stem cells in brain – can make some new neurons!