1. Biotechnology Methods Producing Recombinant DNAProducing Recombinant DNA Locating Specific GenesLocating Specific Genes Studying DNA SequencesStudying DNA Sequences

2. Recombinant DNA DNA Produced by Joining Segments of DNA From Different SourcesDNA Produced by Joining Segments of DNA From Different Sources eg. Bacterial plasmid DNA + Human DNA to Produce Human Insulineg. Bacterial plasmid DNA + Human DNA to Produce Human Insulin

3. Tools for Producing Recombinant DNA Restriction enzymes: enzymes that cleave the DNA double helix at specific nucleotide sequences Restriction enzymes: enzymes that cleave the DNA double helix at specific nucleotide sequences

4. Use of the Restriction Enzyme Bam H1 5’— G G A T C C — 3’ 5’— G G A T C C — 3’ 3’— C C T A G G — 5’ 3’— C C T A G G — 5’ 5’— G G A T C C — 3’ 5’— G G A T C C — 3’ 3’— C C T A G G — 5’ 3’— C C T A G G — 5’ sticky end Results in DNA fragments from different sources can be joined together if they have complementary sticky ends.

5. Producing Recombinant DNA

6. Tools for Producing Recombinant DNA Plasmid: extrachromosomal, independently replicating, small circular DNA molecule; a type of vector used to carry DNA into bacterial cells Plasmid: extrachromosomal, independently replicating, small circular DNA molecule; a type of vector used to carry DNA into bacterial cells

7. DNA Inserted in a Plasmid Can be Detected by Disruption of a Selectable Marker amp R tet R Bam H1 If additional DNA is inserted at the Bam H1 site, the tet R gene is disrupted and is no longer functional amp R

8. Producing Recombinant DNA restriction enzyme Treat source DNA with restriction enzyme Treat plasmid DNA with same enzyme restriction enzyme Mix together Add DNA Ligase Many recombinant DNA molecules are produced, each with a different piece of source DNA Transform bacterial cells Each bacterial cell carries a different recombinant plasmid

9. Tools for Producing Recombinant DNA Probe: sequence of DNA that is complementary to the gene of interest; Used to locate a copy of the gene by hybridization Probe: sequence of DNA that is complementary to the gene of interest; Used to locate a copy of the gene by hybridization Add Probe Probe Binds to gene AGCTTAGCGATTCGAATCGCTA AATCGC AGCTTAGCGATTCGAATCGCTA Denature DNA by heating

10. Tools for Producing Recombinant DNA Library: collection of DNA sequences from one donor that can be screened by a probe to detect the gene of interest Library: collection of DNA sequences from one donor that can be screened by a probe to detect the gene of interest –Genomic library = all of the sequences from the genome of a single organism –cDNA library= complementary DNA, made using mRNA as a template, used to study transcribed sequences

11. Building a Genomic Library

12. Producing cDNA Molecules TTTTTTTT Exon 1Exon 2Exon 3 GAAAAAAAA…… mRNA Reverse transcriptase One strand of cDNA TTTTTTTT AAAAAAAA DNA polymerase TTTTTTTT AAAAAAAA Second strand of cDNA nuclease cDNA To produce a cDNA library, each cDNA from the same cell type would be inserted into a vector

13. Using a Probe to Screen a Library for a Gene of Interest

14. Applying Your Knowledge Which one best describes An enzyme that cleaves DNA at specific sequences?An enzyme that cleaves DNA at specific sequences? A sequence of DNA that is complementary to the gene of interest?A sequence of DNA that is complementary to the gene of interest? A collection of DNA molecules used to find a gene of interest?A collection of DNA molecules used to find a gene of interest? A small, independently replicating DNA molecule?A small, independently replicating DNA molecule? 1.Probe 2.Clone 3.Plasmid 4.Library 5.Restriction Enzyme

15. Biotechnological Methods: PCR http://www.dnalc.org/ddnalc/resources/pcr.html PCR = Polymerase Chain Reaction PCR = Polymerase Chain Reaction  Amplifies a specific region in the DNA  Used for identification, especially if the amount of DNA is small  Uses repeated cycles of heating to denature DNA and cooling to synthesize new DNA  Involves the use of ---Taq polymerase (withstands heat) ---Taq polymerase (withstands heat) ---primers to begin synthesis ---primers to begin synthesis

16. Polymerase Chain Reaction: One PCR Cycle Original Double- helix DNA Separate DNA Strands 90 °C Primers & Taq polymerase bind 50 °C Taq Polymerase Primer 72 °C DNA synthesized

17. Polymerase Chain Reaction: Multiple PCR Cycles DNA fragment to be amplified 2 copies4 copies8 copies

18. DNA Fingerprinting with PCR

19. Biotechnological Methods: RFLP RFLP Analysis Restriction Fragment Length Polymorphism Use of a probe to identify specific DNA fragments derived from restriction enzyme digestion Use of a probe to identify specific DNA fragments derived from restriction enzyme digestion Shows variations in sizes of fragments between different individuals Shows variations in sizes of fragments between different individuals

20. Separation of Restriction Fragments by Size

21. DNA separated by size is transferred from agarose gel to filter DNA on filter is exposed to probe to detect complementary sequences. Southern Blotting for RFLP Analysis

22. RFLP Analysis used for Paternity Testing X X X X X X X X

23. C SR CI EC SR CI EM NE EM NE EC SR CI EC SR CI EM NE EM NE E RFLP Analysis in Forensics 1234567 SuspectsSuspects

24. RFLP Analysis in Genetic Testing On the basis of this analysis, the genotype of the fetus is 1. AS 2. AA 3. SS 4. Unknown