2002 Curt Van Tassell Gene Evaluation and Mapping Laboratory and Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville,

Slides:

Advertisements

Similar presentations

2002 Paul M. VanRaden and Ashley H. Sanders Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD

Advertisements

2003 George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD USDA Dairy Goat.

George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD 2008 Genetic trends.

George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD Select Sires’

Use of Quantitative Trait Loci (QTL) in Dairy Sire Selection Fabio Monteiro de Rezende Universidade Federal Rural de Pernambuco (UFRPE) - Brazil.

Genetic Selection Tools in the Genomics Era Curt Van Tassell, PhD Bovine Functional Genomics Laboratory & Animal Improvement Programs Laboratory Beltsville,

Bull selection based on QTL for specific environments Fabio Monteiro de Rezende Universidade Federal Rural de Pernambuco (UFRPE) - Brazil.

G.R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD 2009 G.R. WiggansCroatian.

Mapping Basics MUPGRET Workshop June 18, Randomly Intermated P1 x P2  F1  SELF F …… One seed from each used for next generation.

2007 Paul VanRaden, George Wiggans, Jeff O’Connell, John Cole, Animal Improvement Programs Laboratory Tad Sonstegard, and Curt Van Tassell Bovine Functional.

G.R. Wiggans 1, T.S. Sonstegard 1, P.M. VanRaden 1, L.K. Matukumalli 1,2, R.D. Schnabel 3, J.F. Taylor 3, J.P. Chesnais 4, F.S. Schenkel 5, and C.P. Van.

Wiggans, 2013RL meeting, Aug. 15 (1) Dr. George R. Wiggans, Acting Research Leader Bldg. 005, Room 306, BARC-West (main office);

ADSA 2002 (HDN-P1) 2002 Comparison of occurrence and yields of daughters of progeny-test and proven bulls in artificial insemination and natural- service.

2012 ADSA-AMPA-ASAS-CSAS-WSASAS joint annual meeting (1)Norman Comparison of daughter performance of New Zealand and North American sires in US herds H.D.

But who will be the next GREAT one?. USA Bull Proofs * Bulls are ranked based upon their DAUGHTER’S (progeny) production and physical characteristics.

G.R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD Georgetown Ag Systems.

2007 Jana L. Hutchison Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD , USA

2007 Paul VanRaden 1, Curt Van Tassell 2, George Wiggans 1, Tad Sonstegard 2, Jeff O’Connell 1, Bob Schnabel 3, Jerry Taylor 3, and Flavio Schenkel 4,

Effects of complex vertebral malformation gene on production and reproduction M. T. Kuhn*, J. L. Hutchison, and C. P. Van Tassell Animal Improvement Programs.

2007 Paul VanRaden 1, George Wiggans 1, Curt Van Tassell 2, Tad Sonstegard 2, Jeff O’Connell 1, Bob Schnabel 3, Jerry Taylor 3, and Flavio Schenkel 4,

WiggansARS Big Data Workshop – July 16, 2015 (1) George R. Wiggans Animal Genomics and Improvement Laboratory Agricultural Research Service, USDA Beltsville,

G.R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD 2010 G.R. WiggansDCRC.

2001 ADSA annual meeting, July 2001 (1) Timeliness of progeny-testing through AI and percentage of bulls returned to service (abstract 1020) H.D. NORMAN,*

2002 Paul M. VanRaden Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD Selection of dairy.

DEPARTMENT OF PRIMARY INDUSTRIES 1 Discovering Genes for Beef Production Mike Goddard University of Melbourne and Department of Primary Indusries, Victoria.

2007 J. B. Cole 1,*, P. M. VanRaden 1, J. R. O'Connell 3, C. P. Van Tassell 1,2, T. S. Sonstegard 2, R. D. Schnabel 4, J. F. Taylor 4, and G. R. Wiggans.

George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD National Association.

G.R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD G.R. WiggansAg Discovery.

Dairy Industry: Selection OBJECTIVES By: Mr. Weaver Identify specific traits associated with making a decision regarding dairy cattle selection. Evaluate.

 PTA mobility was highly correlated with udder composite.  PTA mobility showed a moderate, positive correlation with production, productive life, and.

2007 Paul VanRaden, Curt Van Tassell, George Wiggans, Tad Sonstegard, and Jeff O’Connell Animal Improvement Programs Laboratory and Bovine Functional Genomics.

Enhancing Quality Of Dystocia Data By Integration Into A National Dairy Cattle Production Database C. P. Van Tassell 1,2 and G. R. Wiggans 1 Animal Improvement.

Norway (1) 2005 Status of Dairy Cattle Breeding in the United States Dr. H. Duane Norman Animal Improvement Programs Laboratory Agricultural Research Service,

Bovine Genomics The Technology and its Applications Gerrit Kistemaker Chief Geneticist, Canadian Dairy Network (CDN) Many slides were created by.

REGRESSION MODEL y ijklm = BD i + b j A j + HYS k + b dstate D l + b sstate S l + b sd (S×SD m ) + b dherd F m + b sherd G m + e ijklm, y = ME milk yield,

2007 Paul VanRaden, George Wiggans, Jeff O’Connell, John Cole, Animal Improvement Programs Laboratory Tad Sonstegard, and Curt Van Tassell Bovine Functional.

H. Duane Norman Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD Missouri Dairy Summit.

John B. Cole, Ph.D. Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD, USA The U.S. genetic.

2007 J.B. Cole Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD Overview.

2005 Paul VanRaden Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD An Example from Dairy.

Experimental Design and Data Structure Supplement to Lecture 8 Fall

2005 Paul VanRaden Animal Improvement Programs Laboratory, USDA Agricultural Research Service, Beltsville, MD, USA Selection for.

Adjustment of selection index coefficients and polygenic variance to improve regressions and reliability of genomic evaluations P. M. VanRaden, J. R. Wright*,

2007 Paul VanRaden, George Wiggans, Animal Improvement Programs Laboratory Curt Van Tassell, Tad Sonstegard, Bovine Functional Genomics Laboratory USDA.

2007 Melvin Tooker Animal Improvement Programs Laboratory USDA Agricultural Research Service, Beltsville, MD, USA

WiggansCDCB industry meeting – Sept. 29, 2015 (1) George R. Wiggans Animal Genomics and Improvement Laboratory Agricultural Research Service, USDA Beltsville,

2006 Mid-Atlantic Dairy Grazing Conference, 2006 (1) Is There a Need for Different Genetics in Dairy Grazing Systems? H. D. Norman, J. R. Wright, R. L.

7 th World Congr. Genet. Appl. Livest. Prod Selection of dairy cattle for lifetime profit Paul M. VanRaden Animal Improvement Programs Laboratory.

2007 Paul VanRaden Animal Improvement Programs Laboratory USDA Agricultural Research Service, Beltsville, MD, USA

WiggansARS Big Data Computing Workshop (1) 2013 George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville,

George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD Select Sires’

WiggansARPAS-DC meeting, Beltsville, MD – Dec. 9, 2015 (1) George R. Wiggans Animal Genomics and Improvement Laboratory Agricultural Research Service,

2002 George R. Wiggans and Curt P. Van Tassell Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD

H.D. Norman* J.R. Wright, P.M. VanRaden, and M.T. Kuhn Animal Improvement Programs Laboratory Agricultural.

2007 John Cole, Paul VanRaden, George Wiggans, and Melvin Kuhn Animal Improvement Programs Laboratory USDA Agricultural Research Service, Beltsville, MD,

G.R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD G.R. WiggansADSA 18.

2001 ADSA Indianapolis 2001 (1) Heterosis and Breed Differences for Yield and Somatic Cell Scores of US Dairy Cattle in the 1990’s. PAUL VANRADEN Animal.

2007 Paul VanRaden Animal Improvement Programs Laboratory, USDA Agricultural Research Service, Beltsville, MD, USA 2008 New.

2006 George R. Wiggans Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD USDA Genetic.

John B. Cole Animal Improvement Programs Laboratory Agricultural Research Service, USDA Beltsville, MD Biological Insights.

CRI – Spanish update (1) 2010 Status of Dairy Cattle Breeding in the United States Dr. H. Duane Norman Animal Improvement Programs Laboratory Agricultural.

2007 Paul VanRaden 1, Curt Van Tassell 2, George Wiggans 1, Tad Sonstegard 2, Bob Schnabel 3, Jerry Taylor 3, and Flavio Schenkel 4, Paul VanRaden 1, Curt.

Meori Rosen Past, Present, and Future Dairy Cattle Breeding in Israel.

2001 ASAS/ADSA 2001 Conference (1) Simultaneous accounting for heterogeneity of (co)variance components in genetic evaluation of type traits N. Gengler.

Application of Genetic Markers to Dairy Cattle. Overview Traditional selection Genetic markers Granddaughter design Resource populations QTL identification.

H.D. NORMAN,* R.L. POWELL, J.R. WRIGHT

Distribution and Location of Genetic Effects for Dairy Traits

USDA Dairy Goat Genetic Evaluation Program

Where AIPL Fits In Agricultural Research Service (ARS) is the main research arm of USDA (8,000 employees with 2,000 scientists at >100 locations) Beltsville.

Can you believe those genomic evaluations for young bulls?

Presentation transcript:

2002 Curt Van Tassell Gene Evaluation and Mapping Laboratory and Animal Improvement Programs Laboratory Agricultural Research Service, USDA, Beltsville, MD Application of Genetic Markers to Dairy Cattle

NAAB Dairy Trade Mission – Genetic Marker Evaluation (2) Curt Van Tassell 2002 Overview  Traditional selection  Genetic markers  Granddaughter design  Resource populations  QTL identification  EST sequencing

NAAB Dairy Trade Mission – Genetic Marker Evaluation (3) Curt Van Tassell 2002 Introduction  Traditional dairy cattle breeding has assumed that an infinite number of genes each with very small effect control most traits of interest  Logical to expect some “major” genes with large effect; these genes are usually called quantitative trait loci (QTL)  The QTL locations are unknown!  Genetic markers can provide information about QTL

NAAB Dairy Trade Mission – Genetic Marker Evaluation (4) Curt Van Tassell 2002 Traditional Selection Programs  Estimate genetic merit for animals in a population  Select superior animals as parents of future generations

NAAB Dairy Trade Mission – Genetic Marker Evaluation (5) Curt Van Tassell 2002 Genetic Improvement: Challenges and Technologies Traditional selection Gene mapping and marker assisted selection Transgenics Abundant Genetic variation Limited genetic variation Little or no genetic variation

NAAB Dairy Trade Mission – Genetic Marker Evaluation (6) Curt Van Tassell 2002 Application of Genetic Markers  Identify genetic markers that are associated with changes in genetic merit  Use marker assisted selection (MAS) to make selection decisions before phenotypes are available  Adjust genetic merit for genetic markers

NAAB Dairy Trade Mission – Genetic Marker Evaluation (7) Curt Van Tassell 2002 Useful Genetic Markers:  Allow marker inheritance to be followed across generations  Many different types of marker alleles well represented in the population  Marker and QTL are close together so that recombination between marker and QTL is rare  Best case is when we know the QTL - then it is the marker!

mq MQ Marker Locus Quantitative Trait Locus {{ Linkage Distance NAAB Dairy Trade Mission – Genetic Marker Evaluation (8) Curt Van Tassell 2002

Parental Chromosomes Recombinant Chromosomes Marker Locus Quantitative Trait Locus {{ mq Mq mQ MQ NAAB Dairy Trade Mission – Genetic Marker Evaluation (9) Curt Van Tassell 2002

Parental Chromosomes AB CDEF ab cde f Recombinant Chromosomes * * * * * * * NAAB Dairy Trade Mission – Genetic Marker Evaluation (10) Curt Van Tassell 2002

Genetic Markers NAAB Dairy Trade Mission – Genetic Marker Evaluation (11) Curt Van Tassell 2002

Genetic Markers!! NAAB Dairy Trade Mission – Genetic Marker Evaluation (12) Curt Van Tassell 2002

Genetic Markers NAAB Dairy Trade Mission – Genetic Marker Evaluation (13) Curt Van Tassell 2002

Bull Granddaughter Design NAAB Dairy Trade Mission – Genetic Marker Evaluation (14) Curt Van Tassell 2002

Granddaughter Design Sons NAAB Dairy Trade Mission – Genetic Marker Evaluation (15) Curt Van Tassell 2002

Granddaughter Design NAAB Dairy Trade Mission – Genetic Marker Evaluation (16) Curt Van Tassell 2002

Granddaughter Design DNA Genetic Merit Data NAAB Dairy Trade Mission – Genetic Marker Evaluation (17) Curt Van Tassell 2002

NAAB Dairy Trade Mission – Genetic Marker Evaluation (18) Curt Van Tassell 2002 Resource Populations: Cooperative Dairy DNA Repository (CDDR)  The CDDR is an ongoing collection of all bulls entering progeny tests  Includes all breeds  Useful for QTL mapping in dairy cattle using a granddaughter design and for complex pedigree analysis  Currently (6/01):  Six North American studs contributing semen  9789 bulls in the collection  128 families with at least 25 sons

Compare Genetic Merit QTL Identification NAAB Dairy Trade Mission – Genetic Marker Evaluation (19) Curt Van Tassell 2002

QTL Identification Bull Sons NAAB Dairy Trade Mission – Genetic Marker Evaluation (20) Curt Van Tassell 2002

NAAB Dairy Trade Mission – Genetic Marker Evaluation (21) Curt Van Tassell 2002 USDA-ARS Progress  Over 160 markers studied in over 1000 animals from 8 families  Evaluated all available traits: Conformation traits, M, F, P, SCS, PL, and calving ease  Genome-wide scan across all families was recently completed

NAAB Dairy Trade Mission – Genetic Marker Evaluation (22) Curt Van Tassell 2002 Marker Association Results ChromosomeTrait 3Protein Percentage 4Strength Body Depth 5Dairy Form 6 Protein Percentage 7Somatic Cell Score 12Foot Angle Rear Legs (Rear View) 14Fat Percentage Protein Percentatge Fore Udder Attachment Front Teat Placement 16Udder Depth 18Rump Angle 20Protein Percentatge 22Rump Angle 27 Dairy Form

Family 8 interval analysis results NAAB Dairy Trade Mission – Genetic Marker Evaluation (23) Curt Van Tassell 2002

What is an EST? ATG TAA mRNA ESTs AAAAAAAAA 5’ AAAAAAAAA TTTTTTTTTT 3’ 5’ 3’ 5’ 3’ cDNA Tissue Biopsy mRNA isolation RT-PCR Sequencing of cDNA clones Bioinformatics Bovine Sequence database NAAB Dairy Trade Mission – Genetic Marker Evaluation (24) Curt Van Tassell 2002

NAAB Dairy Trade Mission – Genetic Marker Evaluation (25) Curt Van Tassell 2002 USDA-ARS Bovine EST Projects  Initial goal: Single pass sequencing of 5 bovine cDNA libraries  4 axis MARC = 80,000 EST  1 mammary BARC = 10,000 EST  Mammary cDNA library has stages from prepubertal, mid-gestation, late gestation, cholostrogenesis, lactation, infected lactation, and early and late involution.  Sample diverse developmental stages and morphological cell types to maximize diversity and minimize redundancy

NAAB Dairy Trade Mission – Genetic Marker Evaluation (26) Curt Van Tassell 2002 Status ARS EST sequencing GenBank dbEST database submissions:  231,577 total cattle gene-related sequences  >150,000 cattle ESTs generated by USDA  120,745 cattle sequences 1-4BOV cDNA libraries (MARC)  23,202 cattle sequences 5BOV cDNA library (BARC)

EST Sequence Analysis & Assembly AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGACATTACCTAGG AGCTTTAAGCCATACCTTAGGACATTACCTAGG GCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTC AGCTTTAAGCCATACCTTAGGACATTACCTAGGAGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGAC AGCTTTAAGCCATACCTTAGGGTCAGCTTTAAGCCATACCTTAGGACATTACCTAGG TC EST1 EST2 EST3 EST4 TIGR Bovine Gene Index: Over 67,000 unique sequence elements NAAB Dairy Trade Mission – Genetic Marker Evaluation (27) Curt Van Tassell 2002

Unique Cattle Sequences Rat Gene Index 11,077 28,617 18,292 36,734 10,175 44,367 2,542 31,671 15,238 22,760 24,149 Human Gene Index Mouse Gene Index Human Golden Path TOGA Over 17,000 “no hit” bovine sequence elements. NAAB Dairy Trade Mission – Genetic Marker Evaluation (28) Curt Van Tassell 2002

NAAB Dairy Trade Mission – Genetic Marker Evaluation (29) Curt Van Tassell 2002 Conclusions  Marker assisted selection is an evolutionary improvement over traditional selection methods. It allows more accurate estimation genetic merit of animals  Evidence of important QTL has been found  EST sequencing has been very successful  Lots of interesting findings from EST project that will need additional research