DNA BARCODING CHILLIES BIO-NERDS : Say Wah Yugraj Singh Tanja Obradovic Jenny Pham Lovita Bharossa Buai Chuol Diana Corzo.

Slides:



Advertisements
Similar presentations
Diagnosis with PCR This is a preparation of DNA. We zoomed in a portion of a gene. We know that two primers, Forward and Reverse, will hybridize at specific.
Advertisements

1.1.3 MI.
From Bugs to Barcodes: Using Molecular Tools to Study Biodiversity Mandy Butler, Heather Henter, Stephanie Mel University of California, San Diego.
Robert Hanner, PhD Database Working Group Chair, CBOL Global Campaign Coordinator, FISH-BOL Associate Director, Canadian Barcode of Life Network Biodiversity.
Yaron Fireizen, Vinay Rao, Lacy Loos, Nathan Butler, Dr. Julie Anderson, Dr. Evan Weiher ▪ Biology Department ▪ University of Wisconsin-Eau Claire From.
Explain how crime scene evidence is
DNA Fingerprinting & Gel Electrophoresis
Finding approximate palindromes in genomic sequences.
Master in Advanced Genetics
DNA Fingerprinting Mark Bailey Vicki L. Burnett Walker B. Carroll.
Diabetes and Endocrinology Research Center The BCM Microarray Core Facility: Closing the Next Generation Gap Alina Raza 1, Mylinh Hoang 1, Gayan De Silva.
BioBarcode: a general DNA barcoding database and server platform for Asian biodiversity resources Jeongheui Lim Korean BioInformation Center Korea Research.
Dan Masiga Molecular Biology and Biotechnology Department International Centre of Insect Physiology and Ecology, Nairobi, Kenya BARCODE Data Standard The.
Consortium for the Barcode of Life A rapid, cost-effective system for species identification David E. Schindel, Executive Secretary National Museum of.
DNA Barcoding Dolan DNA Learning Center
Biodiversity Chapter 10.
explain how crime scene evidence is
Molecular Identification Methods Confirmation of identity for commonly used laboratory strains should ideally be done at the level of genotypic analysis’…...
Discovery of new biomarkers as indicators of watershed health and water quality Anamaria Crisan & Mike Peabody.
RACE-Amplification and Cloning of Bluefish Pomatomus saltatrix Cytochrome P450 1A. Abstract: Our study attempted to clone the entire bluefish Cytochrome.
DNA barcoding in Microorganisms
What do these terms mean to you? You have 5 min to discuss possible meanings and examples with your group! DNA sequencing DNA profiling/fingerprinting.
Amplifying DNA. The Power of PCR View the animation at
Insect DNA Barcoding. Agenda DNA Bug Barcoding at FLCC Finger Lakes Invertebrate Biodiversity Study (FLIBS) Introduction to Biology (for majors), Research.
FISH SPECIES IDENTIFICATION AND BIODIVERSIFICATION IN ENUGU METROPOLIS RIVER BY DNA BACODING PRESENTED BY Chioma Nwakanma (PhD) Michael Okpara University.
Flora in our wetlands.. Kamalpreet Kaur Shivanthi Opatha Mona Lau Jessica Jimenez Maria Panayi Alex Marshall.
Chapter 13 Table of Contents Section 1 DNA Technology
Development and Application of SNP markers in Genome of shrimp (Fenneropenaeus chinensis) Jianyong Zhang Marine Biology.
Watson & Crick Discovered the basic shape of DNA
PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays in Drosophila Part I: Gamma rays Nanette Brand 1 Nonhlanhla.
DNA Fingerprinting. Also known as DNA profiling Used in criminal and legal cases since the 1980’s to determine identity or parentage Also used to identify.
Forensic Science: Fundamentals & Investigations, Chapter 7 1 Introduction and History of Biological Evidence in Forensics DNA fingerprinting or DNA profiling,
Human Genomics. Writing in RED indicates the SQA outcomes. Writing in BLACK explains these outcomes in depth.
Phylogeography of Leucetta chagosensis (Porifera, Calcarea) Christoph Flucke, Jens Kurz, Rasmus Liedigk, Zdenka Valenzova Fig.4: RAxML Phylogram Fig.5:
Fish -Nearly half of all vertebrates species : marine, freshwater species (Fish base) FISH-BOL(Fish Barcode of Life Initiative) -Establish.
Northern Star Coral (Astrangia poculata) Populations from the New Jersey Coast. Abstract- This project investigated the distribution and molecular evolution.
Zunera Shabbir PhD 1st semester Department of Botany PMAS AAUR
HRM REAL TIME PCR Presented by: Dadkhah Fahimeh SNP genotyping by HRM REAL TIME PCR.
Bio-Identification of Flake Samples Using DNA Barcoding By Lina Martinez, Jeremy Tallman, Richard Moloney, Chantall Smith, Joanna Wisniewski, Wathsala.
Genetic Engineering and Biotechnology Notes. IB Assessment Statement 4.4.1Outline the use of polymerase chain reaction (PCR) to copy and amplify minute.
Higher Human Biology Unit 1 Human Cells KEY AREA 5: Human Genomics.
 Types of STR markers- 5 types based on sequence  STR allele nomenclature  Allelic ladder  Serological methods of identity profiling  Identity profiling.
Something’s Fishy By Victoria Eavis and Rebecca Mantel Mentored by Patrice Buckley.
Honors Project May 2, 2013 By: Alyssa Rogers Mentor: Dr. Christopher Lane BROWN ALGAL DIVERSITY IN BERMUDA REVEALED USING MOLECULAR TOOLS.
Introduction Biodiversity is important in an ecosystem because it allows the species living in that ecosystem to adapt to changes made in the environment.
Introduction Biodiversity, in the simplest terms, means variation in living systems and that is extremely important to any habitat that wants to continue.
Detecting DNA with DNA probes arrays. DNA sequences can be detected by DNA probes and arrays (= collection of microscopic DNA spots attached to a solid.
Something to Smile About: DNA Barcoding of St. John’s Wort Herbal Supplements Authors: Justin Rubino, Gus Moody Mentor: Vanaja Zacharopoulos, PhD Friends.
Fishy Labels Ethical Culture Fieldston School Zoe Antell, Eliza Epstein and Sarah Rockhill: Howard Waldman Abstract Lately there have been many rumors.
Plant Biodiversity in the Peconic River Methods ●First, 20 leaf samples from the Peconic River Otis Pike Preserve were collected. All the samples are from.
Explain how crime scene evidence is
Evidence of Two Invasive Aquatic Species in Lake Ronkonkoma
Explain how crime scene evidence is
Introduction to Bioinformatics Resources for DNA Barcoding
Introduction Conclusion References Aim of the work
FIRST EUROPEAN FOOD CONGRESS 4-9, November, 2008 Ljubljana, Slovenia
Microsatellite identification via ISSR Protocol:
Qualitative and quantitative assessment of DNA extracted
explain how crime scene evidence is
Molecular Biology lecture -Putnoky
KEY CONCEPT DNA fingerprints identify people at the molecular level.
A Rare Mutation in the Primer Binding Region of the Amelogenin Gene Can Interfere with Gender Identification  Bonnie Shadrach, Mairead Commane, Carol.
1.1.3 MI.
Identification and Evolution of Brunfelsia australis
Explain how crime scene evidence is
explain how crime scene evidence is
9-2 Replication of DNA.
. . Using DNA Barcoding To Measure The Biodiversity in Ants in Residential Areas And Park Areas Authors: Emily Augulis1, Paige Dreher1, Sarah Hussain1.
Presentation transcript:

DNA BARCODING CHILLIES BIO-NERDS : Say Wah Yugraj Singh Tanja Obradovic Jenny Pham Lovita Bharossa Buai Chuol Diana Corzo

INTRODUCTION DNA Barcoding is method that uses a short genetic marker in an organism's DNA for purposes of fingerprinting to identify it as belonging to a particular species. It is important to identify plants in gene banks for study of crops, ecological and botanical improvement. That is why this project was focus on Chillies DNA barcoding, which are plants from the genus Capsicum. The present project describes different DNA sequences obtained from chillies samples, which were collected from house backyards, supermarkets and local vegetable markets in order to examine, compare and investigate these sequences and analyse what species they come from.

BACKGROUND DNA Barcoding first came to the attention of the scientific community in 2003 when Paul Hebert’s research group at the University of Guelph published a paper titled "Biological identifications through DNA barcodes". In it, they proposed a new system of species identification and discovery using a short section of DNA from a standardized region of the genome. That DNA sequence can be used to identify different species, in the same way a supermarket scanner uses the familiar black stripes of the UPC barcode to identify your purchases. “The two gene regions in the chloroplast, matK and rbcL, have been approved as the barcode regions for land plants.

BACKGROUND Chili peppers originated in the Americas. After the Columbian Exchange, many cultivars of chili pepper spread across the world, used in both food and medicine. The five domesticated species of chili peppers are: Capsicum annuum, Capsicum frutescens, Capsicum chinense, Capsicum pubescens and Capsicum baccatum.

OBJECTIVES To extract DNA from chillies samples collected from different outlets, markets and shops around Melbourne, and to compare different DNA sequences obtained from these samples. To learn and apply the Barcoding protocol including the DNA Isolation process, PCR, DNA sequencing, following by PCR amplification and DNA sequencing.

OBJECTIVES To examine if primers used for plant extraction work on Chillies sample, and to analyse if these allow obtaining good results. To investigate how markets are advertising and labelling different varieties of chillies.

METHODOLOGY DNA isolationElectrophoresis DNA Sequencing PCR Amplification Positive Results (DNA bands shown) Negative Results Blast ( DNA Subway) Species Identification

RESULTS Genomic DNA of eight chillie samples were successfully extracted. Also, PCR was done on all samples using the following primer sequences : rbcL barcoding (plants) Forward Primer 5’- TGTAAAACGACGGCCAGTATGTCACCACAAACAGAGACTAAACG- 3’ Reverse Primer 5’- CAGGAAACAGCTATGACGTAAAATCAAGTCCACCRCG- 3’

Cont.. The bands of eight chillie samples tested were within the expected band range, around 580BP

Cont.. DNA were cleaned up using QIAquick PCR Purification kit (Qiagen) and sent to Micromon Monash Medical Center for sequencing. Trace Sequence: GAGTTCCACCTGAAGA BASES

Cont… By using application sequence viewer (software), by applied Biosystems, We trimmed the ends of the sequence which were having errors with peaks of different bases overlapping. As a result we got one continuous strand of sequence with minimum error in it.

Cont.. SAMPLESEQUENCESAMPLE CARACTERISTICS SCIENTIFIC NAME CHILLIE 5 (forward) TGGAGTTCCACCTGAAGAAGCAGGGGCCGCGGTAGCTGCCGAATCTTCTACTGGTACATGGACAAC TGTATGGACCGATGGACTTACCAGTCTTGATCGTTACAAAGGGCGATGCTACCGCATCGAGCGTGTT GTTGGAGAAAAAGATCAATATATTGCTTATGTAGCTTACCCTTTAGACCTTTTTGAAGAAGGTTCCGT TACCAACATGTTTACTTCCATTGTAGGTAATGTATTTGGGTTCAAAGCCCTGCGCGCTCTACGTCTGG AAGATCTGCGAGTCCCTACTGCTTATATTAAAACTTTCCAAGGTCCGCCTCATGGGATCCAAGTTGAA AGAGATAAATTGAACAAGTACGGTCGTCCCCTGTTGGGATGTACTATTAAACCTAAATTGGGGTTAT CTGCTAAAAACTACGGTAGAGCTGTTTATGAATGTCTTC Capsicum annuum CHILLIE 5a (Reverse) CGACCGTACTTGTTCAATTTATCTCTTTCAACTTGGATCCCATGAGGCGGACCTTGGAAAGTTTTAAT ATAAGCAGTAGGGACTCGCAGATCTTCCAAACGTAAAGCGCGCAGGGCTTTGAACCCAAATACATTA CCTACAATGGAAGTAAACATGTTGGTAACGGAACCTTCTTCAAAAAGGTCTAAAGGGTAAGCTACAT AAGCAATATATTGATCTTTTTCTCCAACAACACGCTCGATGCGGTAGCATCGCCCTTTGTAACGATCA AGACTGGTAAGTCCATCGGTCCATACAGTTGTCCATGTACCAGTAAAAGATTCGGCAGCTACCGCGG CCCCTGCTTCTTCAGGTGGAACTCCAGGTTGAGGAGTTACTCGGAATGCTGCCAATATATCAGTATC CTTGGTTTGGTACTCAGGAGTATAATAAGTCAATTTGTACTCTTTAACACC Capsicum annuum Sequence trace file was trimmed and results were blasted using DNA Subway. We found that all chillie samples were members of the CAPSICUM ANNUUM species.

DISCUSSION AND CONCLUSIONS  When performing a Blast search, 8 sequences of 8 different chillie samples returned matches of 99% (range %) maximum identity, representing 1 species (CAPSICUM ANNUUM)

CONCLUSIONS  Eight out of eight chillie samples come from same species ‘’Capsicum Annuum’’; however, these are from different varieties, with different morphological characteristics. Conclusively, it is necessary to have better and specific primers which can differentiate between varieties of same species.

CONCLUSIONS For the DNA sequencing, it was necessary to get a Forward and reverse sequences in order to fill up the gaps of the bases errors and to achieve a maximum identity of samples.

Cont.. As Chillies are consumables as part of human diet, it is important to identify if shops are labelling the product correctly, in order to make sure customers are getting what they are looking for.

Cont.. Accurate species identification remains a basic first step in any study of biodiversity, particularly for global changes and their consequences. DNA barcoding has proved to be a powerful alternative method to traditional morphological approaches, allowing to complement identification techniques for living organisms

Cont.. DNA Barcoding is a rapid, cost-effective and broadly applicable molecular diagnostic technique, which allows species identification. Also, it aid in the planning of regeneration processes by providing an advance notice of specialized resources or environmental conditions that might be required for their culture.