1. PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays in Drosophila Part I: Gamma rays Nanette Brand 1 Nonhlanhla Ngwenya 2 1 Stellenbosch University, 2 University of Pretoria, South Africa Dr Igor Donatovich Alexandrov Genetic Group Laboratory of Nuclear Problems

2. Goal  To detect the quality and frequency of neutron-induced mutational lesions in comparison to gamma ray-induced ones for different genes of Drosophila using PCR assay  Our aim: To study the molecular genetic action of gamma rays ( 60 Co) on the black mutant of Drosophila

3. Polymerase Chain Reaction  The polymerase chain reaction (PCR) is a technique for the in vitro amplification of specific sequences of DNA  PCR allows the detection of different kinds of mutational changes within fragments, deletions locations  PCR result can be positive or negative

4. Model of study Drosophila melanogaster (A) Wild type, (B) Black mutant A B  Well studied example, gene structure known  Has common principal DNA structure with humans  Short life cycle (~15 days)  Permits the study of heritable gene mutation

5. Black gene structure DNA Ex1 Ex2 Ex3 DNA ’ F1 R1 F3 R3 Fragment 1 Fragment 3 F2 R2 Fragment 2 In 1In 2 A B 5’3’ A. Physical map of black gene showing introns (In 1-2) and exons (Ex 1-3). B. Sizes and location of the black gene fragments studied with forward (F) and reverse (R) primers

6. Primer sequence for PCR FragmentPrimerPrimer sequence Annealing temperature ( ○ С) Size of the PCR product (bp) Size of the overlap fragment (bp) 1 F1aggtgagatcggcacctg 64641068 R1ttggctgcaatggggcactcac 45 2 F2acaacactcgcccgagtcca 64641043 R2acactgttgcaggcagc 99 3 F3tggttgctcatttcgaggggt 6464859 R3tcccagttcccaaggcaaggac

7. Methods  DNA isolation  PCR assay  Gel electrophoresis (DNA analysis)

8. Results  22 black mutants studied  66 PCR assays performed  Deletion of 2 fragments for 1 black mutant was detected  21 black mutants have a small DNA alterations not detected by PCR

9. Electrophoresis 1 235 47689 10

10. Conclusion  Gamma rays induce mostly small DNA alterations which cannot be detected by PCR  This study serves as a basis for a study of the molecular genetic action of neutrons

11. Acknowledgements  Dr I. Alexandrov, Dr M. Alexandrova and Liliana Namolovan  Co-presenter

12. Thank You for Your attention

14. Protocol for DNA Isolation Homogenization of tissue Binding of DNA with sorbent Purification step Purified DNA

15. 1 235 4 7 689 10 Lane 1-3 = 1 st fragment, Lane 4, 5 & 7 = 2 nd fragment, Lane 8-10 = 3 rd fragment and Lane 6 = DNA marker