Download presentation
Presentation is loading. Please wait.
Published byBeatrix Griffith Modified over 9 years ago
1
PCR assay of intragenic mutation lesions induced by monoenergetic fission neutrons and gamma rays in Drosophila Part I: Gamma rays Nanette Brand 1 Nonhlanhla Ngwenya 2 1 Stellenbosch University, 2 University of Pretoria, South Africa Dr Igor Donatovich Alexandrov Genetic Group Laboratory of Nuclear Problems
2
Goal To detect the quality and frequency of neutron-induced mutational lesions in comparison to gamma ray-induced ones for different genes of Drosophila using PCR assay Our aim: To study the molecular genetic action of gamma rays ( 60 Co) on the black mutant of Drosophila
3
Polymerase Chain Reaction The polymerase chain reaction (PCR) is a technique for the in vitro amplification of specific sequences of DNA PCR allows the detection of different kinds of mutational changes within fragments, deletions locations PCR result can be positive or negative
4
Model of study Drosophila melanogaster (A) Wild type, (B) Black mutant A B Well studied example, gene structure known Has common principal DNA structure with humans Short life cycle (~15 days) Permits the study of heritable gene mutation
5
Black gene structure DNA Ex1 Ex2 Ex3 DNA ’ F1 R1 F3 R3 Fragment 1 Fragment 3 F2 R2 Fragment 2 In 1In 2 A B 5’3’ A. Physical map of black gene showing introns (In 1-2) and exons (Ex 1-3). B. Sizes and location of the black gene fragments studied with forward (F) and reverse (R) primers
6
Primer sequence for PCR FragmentPrimerPrimer sequence Annealing temperature ( ○ С) Size of the PCR product (bp) Size of the overlap fragment (bp) 1 F1aggtgagatcggcacctg 64641068 R1ttggctgcaatggggcactcac 45 2 F2acaacactcgcccgagtcca 64641043 R2acactgttgcaggcagc 99 3 F3tggttgctcatttcgaggggt 6464859 R3tcccagttcccaaggcaaggac
7
Methods DNA isolation PCR assay Gel electrophoresis (DNA analysis)
8
Results 22 black mutants studied 66 PCR assays performed Deletion of 2 fragments for 1 black mutant was detected 21 black mutants have a small DNA alterations not detected by PCR
9
Electrophoresis 1 235 47689 10
10
Conclusion Gamma rays induce mostly small DNA alterations which cannot be detected by PCR This study serves as a basis for a study of the molecular genetic action of neutrons
11
Acknowledgements Dr I. Alexandrov, Dr M. Alexandrova and Liliana Namolovan Co-presenter
12
Thank You for Your attention
14
Protocol for DNA Isolation Homogenization of tissue Binding of DNA with sorbent Purification step Purified DNA
15
1 235 4 7 689 10 Lane 1-3 = 1 st fragment, Lane 4, 5 & 7 = 2 nd fragment, Lane 8-10 = 3 rd fragment and Lane 6 = DNA marker
Similar presentations
© 2025 SlidePlayer.com Inc.
All rights reserved.