BI420 – Course information Web site: Instructor: Gabor Marth Teaching assistant: Aaron Quinlan

BI420 – Material Lectures (PowerPoints posted on web site) Text

BI420 – Discovery questions

BI420 – Discovery questions Page 36, Discovery question #1.

BI420 – Discovery questions GGGCTCAGCTGTATCAGCCACGTGCCTACAACAATCTGCCCCT

BI420 – Discovery questions

Genome organization and Bioinformatics Gabor T. Marth Department of Biology, Boston College BI420 – Introduction to Bioinformatics

The animal cell

DNA – the carrier of the genetic code

DNA organization – chromosomes

DNA organization – mitochondria

Translation of genetic information

Gene organization

mRNA splicing – alternative splicing

Gene expression

Protein structure

RNA structure

DNA evolution

Mechanisms of molecular evolution

Evolution of chromosome organization

Evolution of gene structure

Evolution of DNA sequence

Genetic variations

1. The informatics of DNA sequencing DNA sequencing informatics

2. Gene prediction, genome annotation

3. Polymorphism discovery and analysis look at multiple sequences from the same genome region use base quality values to decide if mismatches are true polymorphisms or sequencing errors

4. Gene/DNA expression analysis

5. Proteomics

6. Storage/retrieval of Biological data

7. Sequence alignment/similarity search

8. Phylogenetics

9. Evolutionary Genomics

10. Medical Genomics

11. Practical Bioinformatics using LINUX programming in PERL

12. Practical Bioinformatics HIT idcloneIDhspIDstartend CLONE id name received masked 1NH0260K NH0407F ALLELE id hitID nucleotide 11C 22T using and building databases