OEB 192 – 08.11.03 Mutation rate & population size I.

Slides:

Advertisements

Similar presentations

The Five Factors of Evolution

Advertisements

Friday: Lab 3 & A3 due Mon Oct 1: Exam I  this room, 12 pm Please, no computers or smartphones Mon Oct 1: No grad seminar Next grad seminar: Wednesday,

Coalescent Theory & Population Genetics applications Frantz Depaulis Pwd:

Explain why variations in a population are seen as a bell shaped curve. Agenda for Friday Feb 20 th 1.Patterns and Mechanism notes 2.Go over variation.

OEB 192 – Tradeoffs, specialization & pleiotropy.

Last day… started covering basics of heredity & Mendelian genetics Mendel’s experiments showed that heredity is particulate, not blending Started to talk.

BIOS E-127 – Evolution of digital organisms.

OEB 192 – Physiological basis of adaptation.

Miki Lee / OEB 192 – Mobile genetic elements and adaptive mutation.

OEB 192 – Tradeoffs, specialization & pleiotropy.

OEB 192 – Evolution of pathogens (Grenfell et al., 2004)

OEB 192 – Mobile genetic elements and adaptive mutation.

OEB 192 – Mutation rate & population size II.

OEB 192 – Evolution of pathogens (Grenfell et al., Science)

OEB 192 – Phenotypic diversity & epigenetics.

More on neutral theory OEB 192 – Example: Neighbor Joining (NJ) 4. Choose Methods Taxa Characters Species A ATGGCTATTCTTATAGTACG Species B ATCGCTAGTCTTATATTACA.

BIOS E-127 – Prior theme music: “Evolutionary speculation.

OEB 192 – Phenotypic diversity & epigenetics.

Genetic exchange in bacteria/archaea OEB 192 –

BIOS E-127 – Evolution of digital organisms.

BIOS E-127 – Evolution of microbes. An example story BIOS E-127 – (Nature 394:69-72)

OEB 192 – Epistasis. (Segrè et al., Nat. Genet.)

BIOS E-127 – Diversification & co-evolution.

 SC235: Unit 1 Seminar Is it Biotic?. Course Overview  Term: Feb. 2 nd – April 12 th  Course site  Doc sharing  Webliography  Drop box  Communication:

Sources of Inherited Variation Mutations & Sexual Reproduction.

Gregory Shook. Darwin’s Handicaps Mendel’s work was published but ignored Didn’t know how traits are inherited Didn’t know how variation appeared.

Let’s review for the final! No points, just review.

Class Notes 4 Mechanisms of evolution. I. Natural Selection happens because of genetic variation. * If a population looks the same, there can be no evolution.

Biological Evolution AMNH March – May WHAT DOES A LITERATE ADULT SHOULD KNOW ABOUT EVOLUTION? (03/31/11) Definition of evolution Diversity/unity.

AP Biology Chapter 15 – Mechanisms of Evolution

Introduction to Biology. What is Biology? It is the study of life, living things, what they are, how they work, and how they interact with one another.

OEB 192 – Dynamics of adaptation.

E VOLUTION. T ERMS TO KNOW Population Members of the same species living in the same area Genome Genetic make-up of an organism (DNA) Allele A variation.

From Genome: The Autobiography Of A Species In 23 Chapters By: JD and Pete HMXP 102.

HAPPY WEDNESDAY E3 Computer Bellwork: 1.15 minutes for the quiz. 2.Imagine that you are traveling in Madagascar when you find the plant to the right. You.

Trashketball!. 1. A group of similar organisms that can mate with each other and produce fertile offspring…  A. populations  B. species  C. fossils.

HAPPY MONDAY D3 Computer Bellwork: 1. Get a laptop for your table (you and your shoulder partner), go ahead and log in. 2. Have out your Notecard Sticker.

WARM-UP WEDNESDAY 1/20/16 Q.) On a notecard to be turned in, list all of the things you know about Evolution. Q.) En un notecard para entregarse, ponga.

Darwin’s Evolution A Theory of Evolution. How did the giraffe get its long neck ? Lamarck had an idea… Lamarck had an idea… Organisms acquire traits.

10. Natural Selection  Essential Question: How does the evidence of geology, fossils, and comparative anatomy support the theory of evolution?  Learning.

Theory of Evolution by Natural Selection

Chapter 16 Section 1 Genes and Variation

Natural Selection and Adaptation Notes…page 53

Lecture 1: Introduction to Population Genetics

Evolution & Natural Selection

Checkpoint - How Are You Doing?

4 Factors Required for Natural Selection

Evolutionary Biology David Shiuan National Dong Hwa University

Foldable Notes for Evolution, Natural Selection, Variation & Adaptation Megonigal

This is Evolution.

Mechanisms of Evolutionary Change

Genome Science Theme Seminar

Lesson 28 Genetic Factors

Selection and Adaptation Vocabulary

Foldable Notes for Evolution, Natural Selection, Variation & Adaptation Skiados

Welcome to Science (3/21) You can start to take a look at the “genetic twins” from our Human Traits lab, but please DO NOT TOUCH THE CARDS. Please have.

Notes: What is Evolution (Genetic Basis)

What is allele frequency?

Around the room Orders of operations.

Biology 4.6 Inheritance, Variation and Evolution

The Theory of Evolution

Natural selection, Sexual selection & artificial selection

Evolution Notes.

Natural Selection Review

Evolution & Biological Classification

Modern Evolutionary Theory

Overview of the adaptive laboratory evolution experiment.

Mechanisms of Evolutionary Change

Biology & Nature of Science

Evolution Vocab. Terms SB 5.

Presentation transcript:

OEB 192 – Mutation rate & population size I.

Error catastrophe

R.A. Fisher, “The Genetical Theory of Natural Selection”, p.76

Wednesday (11/3): Mutation rate & population size II.

Upcoming talks Friday, 11/7 "Genomic studies of adaptive evolution in defined environments“ David Gresham Princeton (Botstein lab) 3:00 pm (Bauer Forum) Room 425, Northwest Building “The role of neutrality in molecular evolution: Novel variations of an old theme” Peter Schuster University of Vienna & President of the Austrian Academy of Sciences 4:00 pm One Brattle Square, 6th floor, room 616 Directions: