R r R r R r R r R r R r R r The “Gurdon” experiment: Does every cell in an organism contain all the genetic information to make a complete individual?

Slides:

Advertisements

Similar presentations

RNA and Protein Synthesis

Advertisements

Cell Division, Genetics, Molecular Biology

ON OFF regulatory region (on/off switch) coding region (codes for amino acids) A gene is composed of two parts:

2.7 DNA Replication, transcription and translation

DNA Structure Replication Functions (Stores and provides copies of genetic material- genes) – Blueprint (genes) for Protein Synthesis (Enzymes and cell.

Central Dogma of Biology

+ DNA and Protein Synthesis Chapter 5. + DNA – a molecule that stores your information ■ Amino acid chains make up a protein molecule.

Express yourself That darn ribosome Mighty Mighty Proteins Mutants RNA to the Rescue

Genes as DNA: How Genes Encode Proteins

DNA and RNA Notes Part 2 Protein Synthesis.

1 Vocabulary Review Nucleic Acids. 2 Enzyme that unwinds & separates the DNA strands Helicase.

Lesson Overview 13.1 RNA.

Making of Proteins: Transcription and Translation

Microbial Genetics: DNA Replication Gene Expression

Transcription and Translation

Chapter 13.1 and 13.2 RNA, Ribosomes, and Protein Synthesis

RNA and Protein Synthesis

Protein Synthesis: DNA CONTAINS THE GENETIC INFORMATION TO PRODUCE PROTEINS BUT MUST FIRST BE CONVERTED TO RND TO DO SO.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

Protein Synthesis Transcription and Translation DNA Transcription RNA Translation Protein.

Chapter 13 RNA and Protein Synthesis. DNA: The Blueprints The structure of DNA “CUT the Pyramids ”

RNA and Protein Synthesis BIOLOGY Chapter 10-2 and 10-3 (pgs )

RNA. What is RNA?  RNA stands for Ribonucleic acid  Made up of ribose  Nitrogenous bases  And a phosphate group  The code used for making proteins.

Transcription & Translation

Protein Synthesis: Protein Synthesis: Translation and Transcription EQ: What is the Central Dogma and what processes does it involve? Describe processes.

DNA Structure DNA Replication RNA Transcription Translation.

DNA How are cells structured to do the “right” thing?

Structure of DNA DNA is made up of a long chain of nucleotides

Protein Synthesis-Transcription Why are proteins so important? Nearly every function of a living thing is carried out by proteins … -DNA replication.

Protein Synthesis How genes work.

PROTEIN SYNTHESIS TRANSCRIPTION AND TRANSLATION. TRANSLATING THE GENETIC CODE ■GENES: CODED DNA INSTRUCTIONS THAT CONTROL THE PRODUCTION OF PROTEINS WITHIN.

Protein Synthesis Transcription. DNA vs. RNA Single stranded Ribose sugar Uracil Anywhere Double stranded Deoxyribose sugar Thymine Nucleus.

Gene Expression How do genotypes become phenotypes? 23 from mom 23 from dad.

Transcription and Translation. Central Dogma of Molecular Biology  The flow of information in the cell starts at DNA, which replicates to form more DNA.

DNA and RNA DNA and RNA. DNA DNA -Deoxyribonucleic acid DNA -Deoxyribonucleic acid The nucleic acid that stores and transmits the genetic information.

RNA, Transcription, and the Genetic Code. RNA = ribonucleic acid -Nucleic acid similar to DNA but with several differences DNARNA Number of strands21.

Structure and Function of DNA DNA Replication and Protein Synthesis.

DNA Deoxyribose Nucleic Acid – is the information code to make an organism and controls the activities of the cell. –Mitosis copies this code so that all.

DNA vs. RNA DNA DNA – Deoxyribonucleic Acid – Found in a cell’s nucleus – Function: to carry genetic information – Monomer: nucleotide 5 carbon sugar:

Chapter 13 – RNA & Protein Synthesis MS. LUACES HONORS BIOLOGY.

Higher Human Biology Unit 1 Human Cells KEY AREA 3: Gene Expression.

Transcription and Translation Chapter 21. Objectives Summarize how genetic information is encoded in DNA, how it provides instructions for making proteins.

Chapter 13: RNA and Protein Synthesis Mr. Freidhoff.

Ch 12 DNA and RNA 12-1DNA 12-2 Chromosomes and DNA Replication 12-3 RNA and Protein Synthesis 12-4 Mutations 12-5 Gene Regulation 12-1DNA 12-2 Chromosomes.

RNA & Protein Synthesis

DNA Structure Replication Functions (Stores and provides copies of genetic material- genes) – Blueprint (genes) for Protein Synthesis (Enzymes and cell.

Transcription and Translation

SC.912.L.16.3 DNA Replication. – During DNA replication, a double-stranded DNA molecule divides into two single strands. New nucleotides bond to each.

From DNA to RNA.

RNA Ribonucleic Acid Single-stranded

CONTINUITY AND CHANGE.

CONTINUITY AND CHANGE.

From DNA to Proteins Transcription.

5-3 NOTES: RNA AND CENTRAL DOGMA

Protein Synthesis.

Transcription Unit 4 Part I.

Ch 12 DNA and RNA.

Molecular Basis of Heredity

Have your clickers ready!

Gene Expression aka Protein Synthesis.

DNA: The Molecule of Heredity

Genes and Protein Synthesis Review

5-3 NOTES: RNA AND CENTRAL DOGMA

Protein Synthesis.

Protein Synthesis.

DNA Deoxyribonucleic Acid.

Presentation transcript:

R r R r R r R r R r R r R r

The “Gurdon” experiment: Does every cell in an organism contain all the genetic information to make a complete individual?

Unfertilized egg Ultraviolet radiation of egg to destroy nucleus Enucleated egg Host egg

Donor nucleus

Host eggDonor nucleus

How is genetic information copied every time a cell divides? The two strands separate and each strand is used as a template for the synthesis of a new strand.

How is genetic information copied every time a cell divides? DNA polymerase is the enzyme (protein) that carries out DNA replication.

Bacteria have about 5 million basepairs of DNA. Bacteria can divide every 20 minutes. DNA polymerase replicates bacterial DNA at a rate of 4200 basepairs/second.

What is a gene? Genes are the basic units of inheritance. Genes are information to make proteins. one gene one protein

Most higher organisms have 15, ,000 different genes These organisms have the information (DNA) to make 15, ,000 different proteins

How is genetic information stored in DNA? As a sequence of bases (ATGCATTCGCAATT…)

the sequence of amino acids in a protein. the 3-D shape of the protein. the function of the protein. The sequence of bases in DNA determines The sequence of amino acids in a protein determines The 3-D shape of the protein determines

Hemoglobin

DNA Polymerase

DNA cutting enzyme

Receptor protein

Genes are arranged on chromosomes like beads on a string Gene 1Gene 2Gene 3Gene 4Gene 5 DNA

A typical chromosome has thousands of genes Humans have 23 pairs of chromosomes (46 total) Fruit Flies have 4 pairs of chromosomes (8 total) Arabidopsis has 5 pairs of chromosomes (10 total) Gene 1Gene 2Gene 3Gene 4Gene 5 Chromosome

Genes code for proteins Gene 1Gene 2Gene 3Gene 4Gene 5 chromosome Protein 1Protein 2Protein 3Protein 4Protein 5

Central Dogma of Biology

DNA RNA cytoplasm nucleus Transcription: DNA RNA

DNA RNA cytoplasm RNA is transported to cytoplasm nucleus

DNA protein RNA cytoplasm Translation: RNA protein nucleus

DNA RNA protein RNA cytoplasm DNA RNA protein nucleus

Properties of DNA Double stranded Deoxyribonucleic acid Bases: A, G, C and T Properties of RNA Single stranded Ribonucleic acid Bases: A, G, C and U (U = uracil)

… GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG DNA (bases) RNA (bases) Central Dogma of Biology DNA RNA protein transcription

The code in RNA is read three bases at a time translationtranscription

… GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

… GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly - Cys DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

… GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly - Cys - Gly DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

… GGC TGT GGC TAG … CCG ACA CCG ATC … GGC UGU GGC UAG … Gly - Cys - Gly Stop DNA (bases) RNA (bases) Protein (amino acids) Central Dogma of Biology DNA RNA protein transcription translation

The Genetic Code is Universal AUG codes for the amino acid methionine in all organisms (bacteria, fungi, plants, and animals) GGC codes for the amino acid glycine in all organisms (bacteria, fungi, plants, and animals)

The Genetic Code is Universal This fact proves one of Darwin’s most remarkable predictions: All life forms evolved from a common ancestor.

What is a mutation? A mutation is a change in the base sequence in DNA that results in a change in the amino acid sequence of a protein.

… GGC TGT GGC TAG … CCG ACA CCG ATC DNA … GGC TAT GGC TAG … CCG ATA CCG ATC normal mutant RNA … GGC UAU GGC UAG transcription … GGC UGU GGC UAG transcription … Gly - Protein translation Cys- GlyStopTyr- GlyStop

ON OFF regulatory region (on/off switch) coding region (codes for amino acids) A gene is composed of two parts:

Transcription factors turn genes on and off. Transcription factors are proteins that bind to a specific base sequence in DNA. …AGCCTACCAAAAAAGGTTCCA CG… …TCGGATGGTTTTTTCCAAGGT GC…

regulatory region (on/off switch) coding region (codes for amino acids) - Some transcription factors are activators: They turn genes ON.

regulatory region (on/off switch) coding region (codes for amino acids) - Some transcription factors are activators: They turn genes ON. - Some transcription factors are repressors: They turn genes OFF.