RESTRICTION ENZYMES & GENETIC RECOMBINATION BIOLOGY 2/2A Motzko

Saccharin (1879)

Corn Flakes (1899)

Microwave Oven (1945)

Penicillin (1927)

Werner Arber(1969) 1 st To Isolate Restriction Endonucleases (Enzymes)

Restriction Endonucleases Enzymes that cut DNA at specific locations on the strand known as restriction sites Naturally produced by bacteria to protect them against viruses Restriction sites differ depending upon the sequence of nucleotides When restriction enzymes cut the DNA strand they can leave unpaired nucleotides called “sticky ends”

Sticky Ends Allow Restriction Enyzmes To Assist In The Creation Of Recombinant DNA

Boyer & Cohen (1973) – First to create recombinant DNA using restriction enzymes

LAB: Genetic Recombination Purpose: To model the digestion of DNA strands by restriction enyzmes and the synthesis of recombinant DNA To demonstrate how the pGLO plasmid was constructed from bacterial plasmid DNA and two genes: beta-lactamase and GFP.

pGLO Plasmid

5’- CTGACCATGATTACGCCAAGCTTGCAAGGATCCCCG GGTA-3 1)Obtain initial bacterial plasmid sequence (white)

5’- CTGACCATGATTACGCCAAGCTTGCAAGGATCCCCG GGTA-3 3’- GACTGGTACTAATGCGGTTCGAACGTTCCTAGGGGC CCAT-5 1)Obtain initial bacterial plasmid sequence (white) 2)Write out complimentary base pairs (cDNA) for plasmid

5’- CTGACCATGATTACGCCAAGCTTGCAAGGATCCCCG GGTA-3 3’- GACTGGTACTAATGCGGTTCGAACGTTCCTAGGGGC CCAT-5 1)Obtain initial bacterial plasmid sequence (white) 2)Write out complimentary base pairs (cDNA) for plasmid 3)Tape ends of plasmid together 5->3

5’- CTGACCATGATTACGCCAAGCTTGCAAGGATCCCCG GGTA-3 3’- GACTGGTACTAATGCGGTTCGAACGTTCCTAGGGGC CCAT-5 Gec1 HindIII BamH1 Sma1 1)Obtain initial bacterial plasmid sequence (white) 2)Write out complimentary base pairs (cDNA) for plasmid 3)Tape ends of plasmid 5’->3’ 4)Identify the locations on the bacterial plasmid where the following four restriction enzymes will eventually cut the plasmid A) HindIIIB) BamH1C) Sma1D) Gec1

5’- CACAAGCTTAGCATAGATCTAGCTACGCAA-3’ 3’-GTGTTCGAATCGTATCTAGATCGATGCGTT- 5’ HindIIIEcoRVI 5) Identify the Green Fluorescent Protein (GFP) gene (green) using the following restriction enzymes A) HindIIIB) EcoRVI

5’-AATGGTACAATGCTATGCATGGCTATA-3’ 3’-TTACCATGTTACGATACGTACCGATAT-5’ Sma1 6) Identify the β-Lactamase gene (pink) with the following restriction enzymes A) Sma1B) Gec1

Cut the identified sites on all three strands using the patterns in your handout

Splicing The Genes Into The Plasmid Insert the GFP and β-Lactamase Genes into the bacterial plasmid by pairing the complimentary bases in the sticky ends of each segment Tape these complimentary base sequences together