Cell-free Bacterial Yeast Insect Mammalian Protein Expression Systems

Protein Expression in Bacteria 1.Advantages/disadvantages 2.Genetic elements essential for the expression 3.Cloning strategies 4.Overview of the available expression systems and expression strains 5.Design of cloning procedures using the VNTI program

Advantages Fast growth Cheap medium and equipment for growing Good knowledge of the host

Disadvantages Limitation for expression of eukaryotic proteins due to: different frequencies with which the different codons appear in genes of these organisms E.g. CGT, CGC, CGG, AGG, AGA, CGA code for arginine, but the last 3 (AGG, AGA, CGA) are rarely used in E. coli and it has low amounts of respective tRNAs. differences in post-translational modifications (SS bonds, glycosylation etc)SS bonds, glycosylation

Disadvantages Accumulation of lipopolysaccharides (generally referred to as endotoxins) …

Goals To obtain as much as possible /good expression+good cell growth soluble folded protein /reduced aggregation in a form that is easy to purify /use of secretion and tags Common problem: High expression=danger of aggregation, decreased cell growth

Genetic Elements Essential for Expression

RBS, START, and STOP RBS RBS 5-9 n START GAAGGAATTCAGGAGCCCTTCACCATG Ribosome Bindind Site (RBS): START codons: E. coli uses 77% ATG (AUG), 14% GTG (GUG), 8% TTG (UUG) and a few others STOP codons: TAG (UAG), TGA (UGA), TAA (UAA)

Genetic Elements Essential for Expression

Promoters Host’s promoters 2500 in the entire genome of E. coli K12 strain Most frequently used: Plac / Ptac / Ptrc, P PBAD, rha PBAD -Regulation of expression Promoters from phages T7, T3, SP6, T5, P L - Highly efficient and specific expression

Plac: Regulation

Plac, Ptac, Ptrc: Characteristics Level of expression (inductor) Key features PlacLow level up to middle (IPTG) Weak, regulated. Suitable for expression of gene products at very low intracellular level. Comparatively expensive induction. Ptac Ptrc (trp-lac) Moderately high (IPTG) High-level, but lower than T7 system. Regulated expression still possible.Comparatively expensive induction. High basal level.

P PBAD : Regulation

P PBAD and Rha PBAD Level of expression (inductor) Key features P PBAD Variable from low to high level (L-arabinose) Can fine-tune expression levels in a dose-dependent manner. Tight regulation possible. Low basal level. Inexpensive inducer. rha PBAD Variable from low to high level (L-rhamnose) Tight regulation. Low basal activity. Relatively expensive inducer.

Phage Promoters Level of expression (inductor) Key features T7 T5 Very high High Utilizes T7 RNA polymerase. Utilizes E. coli RNA polymerase. PLPL Moderately high (temperature shift) Temperature-sensitive host required. Less likelihood of "leaky" un-induced expression. Basal level; high basal level by temperatures below 30°C. No inducer.

Combinations

Genetic Elements Essential for Expression

Replication Origin PlasmidRepliconCopy Number pBR322pMB pUC pACYCp15A18-22 pSC101 5 colE

Co-expression from two plasmids

Protein Expression in Bacteria Part2 1.Cloning strategies 2.Overview of the available expression systems and expression strains 3.Design of cloning procedures using the VNTI program

Types of Expression Vectors

Insertion into Transcriptional Vectors

Insertion into Translational Vectors

Cloning Using Restriction Enzymes NcoI HindIII

Cloning Using A-overhangs

TA-Cloning with Topoisomerase

Directional Cloning CACC

Gateway Technology

Expression of Fusion Proteins We may fuse the target protein with various tags to facilitate its purification or detection HHHHHH-target, epitope-target highly soluble proteins to improve solubility and to facilitate purification Thioredoxin-target, GST-target signal peptides or other proteins or domains to promote secretion SP-target

‘Short’ Fusion Protein Construction ATG CAT CAC CAT CAC CAT CAC

‘Long’ Fusion Protein Construction NcoIHindIII PstI

pUC18/19 Transcriptional vector

pTrc99 Translational vector

pQE Translational vector + CDR

pET

pCR&pEXP

pBAD

Expression strains

Expression optimization To optimase: Level of inducer (e.g. arabinose) Time of induction Temperature of the induction step (popular - 18 o C overnight)