The Wonderful World of Repressors Supriya Pokhrel, Firras Garada, Sonia Sharma, Kristen Wade, Trevor Faske, Mandi Feinberg

Background - Repressor protein binds to upstream promoter regions - blocks transcription of downstream genes - allows for regulation of lytic vs. lysogenic cycles

Conserved Domains of Repressor Proteins in Mycobacteriophages By Supriya Pokhrel

Repressor and its domains Is the repressor conserved mostly in the C- terminal domain or N-terminal domain of various phages?

LIST OF PHAGES THAT HAVE SIMILAR REPRESSOR PROTEIN

Motifs compared to lambda phage

Protein Sequence of λ Repressor CTD Sequence

Conserved regions were found mostly in the C-Terminal domain

References Timothy L. Bailey and Charles Elkan, "Fitting a mixture model by expectation maximization to discover motifs in biopolymers", Proceedings of the Second International Conference on Intelligent Systems for Molecular Biology, pp , AAAI Press, Menlo Park, California, Bell, Charles E. “Crystal Structure of the λ Repressor C- Terminal Domain Provides a Model for Cooperative Operator Binding.” Cell Press, June Volume 101, Ganguly, Tribid and Bandhu, Amitava. “Repressor of temperate mycobacteriophage L1 harbors a stable C-terminal domain and binds to different operator DNAs with variable affinity.” Virology Journal 2007, 4:64.

CI Repressor Protein in Lactococcus Phage TP901 and like Proteins By Firras Garada

Background Info Mor First Protein Transcribed = Lytic State CI First Protein Transcribed = Lysogenic Stage

Claim and So What Claim – When the CI repressor protein was mutated it can block transcription of MOR protein So what – Do other phages have a protein similar to the CI repressor protein that may function the same?

Top Hits for Proteins Similar to Repressor Protein of TP901 (tp901-1.p-tp901-1p04)

Motif Results

Data From the Motif Comparison there are 5 other proteins that are closely related to the Repressor Protein of tp901 However 4 of those are other Lactococcus Phages BUT one was an Enterococcus Phage

Alignment of Comparison

Conclusion It is highly probably that other Lactococcus phages have a protein similar to the original CI repressor protein It is probable that Enterococcus Phage phiEf11 may also have a protein very similar to the original Ci repressor and may also be mutated to control what pathway the phage takes

References Characterization of the CI Repressor Protein Encoded by the Temperate Lactococcal Phage TP901-1 Margit Pedersen, Małgorzata Ligowska, Karin Hammer J Bacteriol April; 192(8): 2102–2110. Published online 2010 January 29. doi: /JB

Locating the Repressor Binding Sites in the Bacteriophages Presented by Sonia Sharma BNFO 301

CONIDENTIAL21 Repressors What are They Repressor are proteins when present can lead to Lysogenic pathway Block the PR (lytic) promoter, facilitating the binding of RNA polymerase to the PRM (lysogenic) promoter Leading to synthesis of CI (orange) Repressor They bind to specific, upstream sequences

CONFIDENTIAL 22 Model- E.Coli phage lambda Repressor-CI Ideal binding sites in e-lambda OR1 OR2 Repressor binds as a Dimer at specific palindromic sequences Phage Repressor Anti- Repressor

CONFIDENTIAL23 Intergenic sequence CATACGTTAAATCTATCACCGCAAGGGATAAATATCTAACACC GTGCGTGTTGACTATTTTACCTCTGGCGGTGATAATGGTTGCA TGTACTAAGGAGGTTGTATG

CONFIDENTIAL24 Method Similar sequences were found in known phages- e-lambda, L5, Che12 BXb1 Two unknown phages- Packman Shaka

CONFIDENTIAL25

CONFIDENTIAL26

CONFIDENTIAL27

Graphical map of e- lambda/che12 CONFIDENTIAL28

CONFIDENTIAL29

CONFIDENTIAL30

CONFIDENTIAL31

CONFIDENTIAL32 Observations CI repressor in e-lambda has fewer binding sites L5 and Bxb1 - Genome contains large number of binding site (29 and 34 each) in intergenic regions in only one orientation relative to transcription direction. Che12 has 16 such sites also located in non coding region close to start and stop codon, orientation of sites correlates to the direction of transcription Shaka and Packman each show 16 and 18 putative sites each 21 nucleotides wide Protein alignment- L5, Bxb1 and Che12 more similar then e- lambda

CONFIDENTIAL33 Concluding thought Do majority of Phages follow e-lambda style or L5 yet to be analyzed

CONFIDENTIAL34 References Source- Jeff Elhai, Gene Regulation and Phage, Center for the Study of Biological Complexity, Virginia Commonwealth University Gomathi, N S, Sameer, H, Kumar, V, et al. (2007). In silico analysis of mycobacteriophage che12 genome: Characterization of genes required to lysogenise mycobacterium tuberculosis. Computational biology and chemistry, 31(2), Oppenheim, A B, Kobiler, O, Stavans, J, et al. (2005). Switches in bacteriophage lambda development. Annual review of genetics, 39,

By: Kristen Wade

Repressor Protein (two subunits) Image adapted from:

Repressor Protein (two subunits) Contacted bases Image adapted from:

Repressor Protein (two subunits) Contacted bases Bases NOT contacted by protein Image adapted from:

Contacted bases Bases NOT contacted by protein Image adapted from: Do these non-contacted nucleotides have a function in protein-DNA binding? Repressor binding sites of phage P22 From: Wu et al (1992) J Biol Chem 267:

 Essential for structural adjustment of DNA that allows protein interaction with contacted bases ▪ Wu et al, 1992

Can these sites be identified and given functional significance in phages whose repressors are unrelated to P22?

1. Centrally located within operator motifs

2. Surrounded by a palindromic sequence A T AAG CTT A T

1. Centrally located within operator motifs 2. Surrounded by a palindromic sequence 3. Display greater sequence diversity than surrounding positions Nucleotide Frequency Nucleotide Position A = solid line C = _._. G = _ _ _ _ T = ----

 Operators were collected using Motifs-In  Upstream-Sequences-Of  Repressor Protein of specific phage

Chi Squared: Sum of (O-E)^2 E

A: C: G: T: Predicted Chi square values for each nucleotide:

A: C: G: T: Predicted Chi square values for each nucleotide: Degrees of freedom: 3 Critical value: 0.05 Significance score must be > 7.815

A: C: G: T: Predicted Chi square values for each nucleotide: Degrees of freedom: 3 Critical value: 0.05 Significance score must be > 7.815

Observed: A C G T Expected: A C G T

Observed: A C G T Expected: A C G T A: C: G: T:

 Apply method used on Lambda and U2 to predicted Indirect Readout Sites of other, unrelated phages  Greater number of sequences = greater likelihood of significance

 Indirect readout of DNA sequence by p22 repressor: roles of DNA and protein functional groups in modulating DNA conformation. Lydia-Ann Harris, Derrick Watkins, Loren Dean Williams, Gerald B Koudelka (2013) Journal of molecular biology 425 (1) p Indirect readout of DNA sequence by p22 repressor: roles of DNA and protein functional groups in modulating DNA conformation.  Non-contacted bases affect the affinity of synthetic P22 operators for P22 repressor. L Wu, A Vertino, G B Koudelka (1992)The Journal of biological chemistry 267 (13) p Non-contacted bases affect the affinity of synthetic P22 operators for P22 repressor.  Image:

Incomplete Repressors and Characteristics in Phages Mandi Feinberg BNFO 301 Spring 2013

Phage Bacteria attP attB C Terminal end Repressor N Terminal end Repressor Complete Repressor

Phages Bacteria

Charlie “TGGTGCCCCCAGCTGGGCTCGAACCAGCGACCTGCGGATTACCAG" Acintobacteriophage Acj9 TCGAACCAGCGACCTGCGGATT between tRNA – Cys & Gly Mycobacteriophage LeBron GGTGCCCCCAGCAGGACTCGAACCTGCGACC tRNA-cys (Lys) Mycobacteriophage UPIE GGTGCCCCCAGCAGGACTCGAACCTGCGACCTG tRNA- cys/ lys

Brujita “TGGGAGCCGCCTGGGGGAATCGAACCCCCGACCTATTCATTATCA” Mycobacteriophage Island3 TGATAATGAATAGGTCGGGGGTTCGATTCCCCCAGGCGGCTCCCA phage antirepressor protein tyrosine integrase Mycobacterium Phage Babsiella TGATAATGAATAGGTCGGGGGTTCGATTCCCCCAGGCGGCTCCCA integrase (Y-int)

BPS "AAGTGCGCCCGGAGGGATTCGAACCCCCAACCTTCTGTTT" Mycobacteriophage Angel AAACAGAAGGTTGGGGGTTCGAATCCCTCCGGGCGCACTT phage repressor phage integrase Mycobacteriophage Hope AAACAGAAGGTTGGGGGTTCGAATCCCTCCGGGCGCACTT integrase repressor Mycobacteriophage Halo AAACAGAAGGTTGGGGGTTCGAATCCCTCCGGGCGCACTT

The End? Tried same techniques with Acintobacteriophage Acj9 Characteristics Use characteristics to find more in other types of phages

Works Cited Broussard, Gregory W., Lauren M. Oldfield, Valerie M. Villanueva, Bryce L. Lunt, Emilee E. Shine, and Graham F. Hatfull. "Integration-Dependent Bacteriophage Immunity Provides Insights into the Evolution of Genetic Switches." Molecular Cell 49 (2013): Intro to BNFO 301 Exam 2 The Genetic Switch Regulating Activity of Early Promoters of the Temperate Lactococcal Bacteriophage TP901-1 The Genetic Switch Regulating Activity of Early Promoters of the Temperate Lactococcal Bacteriophage TP901-1 Peter Lynge Madsen, Annette H. Johansen, Karin Hammer, Lone Brøndsted J Bacteriol December; 181(24): 7430–7438.

TREVOR FASKE Phage cI Repressors: the effects on transcriptional/translational direction

Enterobacteria Phage P22

Similar cI Repressors Q-START Q-END TARGET T-START T-END E-VALUE %ID T- ORGANISM 1. Ent-P22.p-P22p Ent-P22.p-P22p d Enterobacteria-phage- P22 2. Ent-P22.p-P22p DE3.p-ECD_ d Enterobacteria-phage- DE3 3. Ent-P22.p-P22p ST64T.p-ST64Tp d Salmonella-phage- ST64T 4. Ent-P22.p-P22p P27.p-P27p d Escherichia-phage-P27 5. Ent-P22.p-P22p Ent-1717.p-Stx2-1717_gp e Stx2-phage Ent-P22.p-P22p VT2-Sa.p-VT2-Sap e Escherichia-phage- VT2-Sa 7. Ent-P22.p-P22p VP882.p-VPVV882_gp e Vibrio-phage-VP Ent-P22.p-P22p VHML.p-VHMLp e Vibrio-phage-VHML 9. Ent-P22.p-P22p Phi-47.p-Phi e Staphylococcus- phage Ent-P22.p-P22p A.p-2638A e Staphylococcus- phage-2638A

Surrounding Proteins Does cI repressors role in directional also play a part in alignment and function of proteins up- and down stream?

Motif and Alignment of cI

(<- Ent-P22.P22p21 Phage protein) 0Ent-P22.P22p21 (<- Ent-P22.P22p22 Phage protein) 36Ent-P22.P22p22 (<- Ent-P22.P22p23 Restriction alleviation ral # )214Ent-P22.P22p23 (-> Ent-P22.P22p24 Phage superinfection exclusion) 20Ent-P22.P22p24 (<- Ent-P22.P22p25 Phage antitermination protein ) 353Ent-P22.P22p25 (<- Ent-P22.P22p26 Phage cI repressor # ACLAME 5) 80Ent-P22.P22p26 (-> Ent-P22.P22p27 Phage repressor # ACLAME 146)106Ent-P22.P22p27 (-> Ent-P22.P22p28 Phage repressor protein CII) 34Ent-P22.P22p28 (-> Ent-P22.P22p29 Phage protein) 0Ent-P22.P22p29 (-> Ent-P22.P22p30 Origin specific replication in) 0Ent-P22.P22p30 (-> Ent-P22.P22p31 Phage replicative DNA helicase)Ent-P22.P22p31 (<- DE3.ECD_10016 Phage repressor protein CIII) 72DE3.ECD_10016 (<- DE3.ECD_10017 Single stranded DNA-binding pr) 182DE3.ECD_10017 (<- DE3.ECD_10018 Restriction alleviation ral # ) 0DE3.ECD_10018 (<- DE3.ECD_10019 Phage protein) 8DE3.ECD_10019 (<- DE3.ECD_10020 Phage antitermination protein ) 314DE3.ECD_10020 (<- DE3.ECD_10021 Phage cI repressor (ACLAME 5)) 80DE3.ECD_10021 (-> DE3.ECD_10022 Putative phage repressor (ACLA) 115DE3.ECD_10022 (-> DE3.ECD_10023 Phage repressor protein CII) 32DE3.ECD_10023 (-> DE3.ECD_10024 Origin specific replication in) 0DE3.ECD_10024 (-> DE3.ECD_10025 Origin specific replication bi) 0DE3.ECD_10025 (-> DE3.ECD_10026 Serine/threonine protein phosp)DE3.ECD_10026 (<- ST64T.ST64Tp20 Phage repressor protein CIII) 63ST64T.ST64Tp20 (<- ST64T.ST64Tp21 Phage superinfection exclusion) 171ST64T.ST64Tp21 (<- ST64T.ST64Tp22 Phage pentapeptide repeat fami) 0ST64T.ST64Tp22 (<- ST64T.ST64Tp23 Restriction alleviation ral # ) 78ST64T.ST64Tp23 (<- ST64T.ST64Tp24 Phage antitermination protein ) 557ST64T.ST64Tp24 (<- ST64T.ST64Tp25 Phage cI repressor # ACLAME 5) 76ST64T.ST64Tp25 (-> ST64T.ST64Tp26 Phage repressor) 110ST64T.ST64Tp26 (-> ST64T.ST64Tp27 Phage repressor protein CII) 173ST64T.ST64Tp27 (-> ST64T.ST64Tp28 Origin specific replication in) 0ST64T.ST64Tp28 (-> ST64T.ST64Tp29 DNA helicase (EC ), pha) 74ST64T.ST64Tp29 (-> ST64T.ST64Tp30 Phage protein # ACLAME 1442)ST64T.ST64Tp30 (<- Ent-1717.Stx2-1717_gp15 Phage repressor protein CIII) 72Ent-1717.Stx2-1717_gp15 (<- Ent-1717.Stx2-1717_gp16 Single stranded DNA-binding pr) 182Ent-1717.Stx2-1717_gp16 (<- Ent-1717.Stx2-1717_gp17 Phage protein) 58Ent-1717.Stx2-1717_gp17 (<- Ent-1717.Stx2-1717_gp18 Phage anti-termination protein) 656Ent-1717.Stx2-1717_gp18 (<- Ent-1717.Stx2-1717_gp19 Phage protein) 501Ent-1717.Stx2-1717_gp19 (<- Ent-1717.Stx2-1717_gp20 Phage cI repressor # ACLAME 5) 116Ent-1717.Stx2-1717_gp20 (-> Ent-1717.Stx2-1717_gp21 Phage repressor) 141Ent-1717.Stx2-1717_gp21 (-> Ent-1717.Stx2-1717_gp22 Phage repressor protein CII) 32Ent-1717.Stx2-1717_gp22 (-> Ent-1717.Stx2-1717_gp23 Phage protein) 0Ent-1717.Stx2-1717_gp23 (-> Ent-1717.Stx2-1717_gp24 Origin specific replication in) 0Ent-1717.Stx2-1717_gp24 (-> Ent-1717.Stx2-1717_gp25 Phage replicative DNA helicase)Ent-1717.Stx2-1717_gp25 (<- VT2-Sa.VT2-Sap19 Phage protein) 0VT2-Sa.VT2-Sap19 (<- VT2-Sa.VT2-Sap20 Phage protein) 58VT2-Sa.VT2-Sap20 (<- VT2-Sa.VT2-Sap21 Putative anti-termination prot) 384VT2-Sa.VT2-Sap21 (-> VT2-Sa.VT2-Sap22 Phage protein) 110VT2-Sa.VT2-Sap22 (<- VT2-Sa.VT2-Sap23 Phage protein) 501VT2-Sa.VT2-Sap23 (<- VT2-Sa.VT2-Sap24 Phage cI repressor # ACLAME 5) 57VT2-Sa.VT2-Sap24 (<- VT2-Sa.VT2-Sap25 Phage cI repressor # ACLAME 5) 75VT2-Sa.VT2-Sap25 (-> VT2-Sa.VT2-Sap26 Phage repressor) 141VT2-Sa.VT2-Sap26 (-> VT2-Sa.VT2-Sap27 Phage repressor protein CII) 171VT2-Sa.VT2-Sap27 (-> VT2-Sa.VT2-Sap28 Phage replication initiation p) 0VT2-Sa.VT2-Sap28 (-> VT2-Sa.VT2-Sap29 DNA helicase (EC ), pha)VT2-Sa.VT2-Sap29 P22DE3ST64T STX2VT2

Protein Alignment

Potential further discoveries Upstream/Downstream sequences using cI repressor motif Motifs in predicted “like” proteins Use this information for annotations

References Jeff Elhai, Introduction to Bioinformatics 301, Center for the Study of Biological Complexity, VCU