Mutations: Changes in Genes

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Mutations Hollywood’s images of mutation.

DNA Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA.

Mutations Gene Mutations Change in the nucleotide sequence of a gene May only involve a single nucleotide May be due to copying errors, chemicals, viruses,

DNA Mutations What is a mutation? 1) Change in the DNA of a gene. 2) When a cell puts its genetic code into action it is making precisely the proteins.

NOTES – CH 17, part 2 DNA & MUTATIONS

Mutations. What comes to mind???? Mutants.

MUTATIONS. Mutations are heritable changes in genetic information Only mutation in the GAMETES can be passed on from generation to generation There can.

 During replication (in DNA), an error may be made that causes changes in the mRNA and proteins made from that part of the DNA  These errors or changes.

4.12 DNA and Mutations. Quick DNA Review Base pairing Base pairing.

8.7 Mutations KEY CONCEPT Mutations are changes in DNA that may or may not affect phenotype.

BIOLOGY FALL 2014 MUTATIONS. WHAT ARE MUTATIONS? Mutations = changes in the genetic material Mutations can happen when cells make mistakes in copying.

Mutations. What Are Mutations? Changes in the nucleotide sequence of DNA May occur in somatic cells (aren’t passed to offspring) May occur in gametes.

Mutations Aka, Pobody’s Nerfect.

Mutations SBI3U Ms. Lefebvre

Mutations 6/26/2018 SB2d.

Gene Mutations A change in the DNA of a gene is called a mutation. Mutations in gametes can be passed on to the offspring of the affected individual,

Review: Can you tell the story of protein synthesis?

Gene Mutations Chapter 11.

Mutations Add to Table of Contents – p. 14

Gene Mutations.

Gene Mutations Essential Question: How do changes in the DNA nucleotide sequence affect the resulting protein?

Types of point mutations

To be successful today…

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

A mutation is a change in an organism’s DNA.

Mutations Ms MacCormack Fall 2018.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Draw a conclusion from this graph for both the red and blue line

DNA: The Blueprints For Life

DNA (Gene) Mutations.

Mutations 1) Gene Mutations = change in pattern of DNA bases

Presentation transcript:

Mutations: Changes in Genes

Point Mutations A point mutation is a change in a single base pair in the DNA. Analogy: THE CAT ATE THE RAT -original THE BAT ATE THE RAT -point mutation

Example of a Point Mutation Sickle cell anemia is caused by a single point mutation in the gene for hemoglobin (the protein that makes up red blood cells). Sickle cell blood cell compared to normal blood cell

Not all point mutations result in defective proteins Not all point mutations result in defective proteins. Example: may not change amino acid sequence.

Frameshift Mutation Frameshift mutation: Insertion or deletion in a base. Shifts the codon pattern. Analogy: THE CAT ATE THE RAT- original THE ATA TET HER AT - frame shift (C deleted)

Frame shift: Changes the reading pattern of the 3 nucleotide codon sequence Therefore, changes the entire amino acid sequence after the mutation. Likely to be harmful.

Mutations can occur as random mutations during replication of DNA Mutations can occur as random mutations during replication of DNA. Mutagens: Factors that make mutations more likely to occur. - UV Radiation - certain chemicals (carcinogens)