Section 20.4 Mutations and Genetic Variation

Slides:

Advertisements

Similar presentations

Chapter 13.3 (Pgs ): Mutations

Advertisements

Chapter 17.5 Gene expression and Mutations

DNA Mutations Biology 6(E).

Introduction  Let’s Read – page 687 paragraph one  What of this to do we agree with?  What don’t we agree with and why?

MUTATIONS SC STANDARD B-4.9: The student will exemplify ways in which new characteristics are introduced into an organism or a population.

Mutations Chapter 12.4.

BIG QUESTIONS: 1.ARE ALL MUTATIONS BAD? EXPLAIN.. 2.CAN EVOLUTION OCCUR IN ABSENCE OF MUTATIONS?

Definition : Any change in the nucleotide sequence of DNA.

Introduction A mutation is a change in the normal DNA sequence. They are usually neutral, having no effect on the fitness of the organism. Sometimes,

Point Mutations Silent Missense Nonsense Frameshift.

8.7 Mutations A mutation is a change in an organism’s DNA. This may or may not affect phenotype.

Fantasy Mutations Reality. Mutations: a permanent and heritable change in the nucleotide sequence of a gene. Are caused by mutagens (x-rays and UV light)

Genetic Mutations Occur in any organism, from people and other animals to plants, bacteria, fungi, and protists. A mutation is any change in the nucleotide.

Central Dogma of Molecular Biology Genetic information flows in one direction – from DNA to RNA to proteins.

Mutation. What you need to know How alteration of chromosome number or structurally altered chromosomes can cause genetic disorders How point mutations.

A change in the nucleotide sequence of DNA Ultimate source of genetic diversity Gene vs. Chromosome.

The Cell Cycle.

MOLECULAR GENETICS Mutations Definition

12.4 Assessment Answers.

Mutations 6/26/2018 SB2d.

Gene Mutations.

A mutation is a change in an organism’s DNA.

Gene Mutations.

GENETIC MUTATIONS Section 5.6 Pg. 259.

Mutations Chapter 12-4.

Types of Mutations.

DNA and mutations SC.912.L.16.4.

Mutations Add to Table of Contents – p. 14

Mutations By: Ayan Mohamud.

Chapter 6.3 McGraw-Hill Ryerson Biology 12 (2011)

Types of point mutations

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations -changes in a single base pair in DNA=changes in the nucleotide.

Mutations changes in the DNA sequence that can be inherited

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

UNIT: DNA and RNA What is a mutation and how does it cause changes in organisms? Mutations Alternative alleles (traits) of many genes result from changes.

Do Now What is the central dogma of biology?

Some mutations affect a single gene, while others affect an entire chromosome.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutations Ms MacCormack Fall 2018.

Copyright Pearson Prentice Hall

Mutations Chapter 8.7.

What if this DNA… CACGTGGACTGAGGACTCCTC …was changed to this DNA?

Copyright Pearson Prentice Hall

Mutation: Some Definitions

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Mutation Notes.

Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall

Copyright Pearson Prentice Hall

PART 4 - Mutations and Genetic Recombination

Genes & Mutations Miss Richardson SBI4U.

Genetic Mutations.

A mutation is a change in an organism’s DNA.

A mutation is a change in an organism’s DNA.

Academic Biology Notes

Changes in DNA TEK 6E: identify and illustrate changes in DNA and evaluate the significance of these changes.

Protein Synthesis and Mutation

Copyright Pearson Prentice Hall

DNA Mutations Types & their effects.

Copyright Pearson Prentice Hall

Gene Mutations.

Presentation transcript:

Section 20.4 Mutations and Genetic Variation Chapter 20 Section 20.4 Mutations and Genetic Variation

Mutations Mutations are changes in the sequence of a DNA molecule. Mutations provide a source of new genetic variation to a population. Mutations can be: Beneficial – help an organism survive. Neutral – does not affect survival. Harmful – hinder an organisms survival.

2 Main Types of Mutations Point Mutation - a mutation that alters only one base pair. Gene Mutation - a mutation that changes the coding for amino acids.

Point Mutation

Gene Mutation

Other Mutations The following mutations can be classified as point or gene mutations based on the specific changes they make to the DNA sequence. Silent Mutation Missense Mutation Nonsense Mutation Frameshift Mutation Deletion Insertion Translocation Inversion

Silent Mutation A mutation that does not result in a change in the amino acid coded for.

Missense Mutation A mutation that results in the single substitution of one amino acid in the polypeptide.

Nonsense Mutation A mutation that converts a codon for an amino acid into a stop codon.

Frameshift Mutation A mutation that causes the reading frame of codons to change. Can either be caused by the insertion or deletion of nucleotides.

Deletion The elimination of a base pair or group of base pairs from a DNA sequence.

Insertion The placement of an extra nucleotide(s) in a DNA sequence.

Translocation The transfer of DNA from one site in the genome to another location.

Inversion The reversal of a segment of DNA.

Causes of Genetic Mutation Genetic mutations can either be spontaneous or induced. Spontaneous mutations – occur as a result of errors made during DNA replication. Induced mutations – are caused by a foreign chemical agent or radiation. Substances that induce mutations are known as mutagenic agents. Examples: UV radiation, cosmic rays, X-rays, tobacco, viruses, alcohol, STI’s, etc.

Inferring Relationships from DNA Sequences Unit C: Cell Division, Genetics and Molecular Biology Inferring Relationships from DNA Sequences Phylogeny – the proposed evolutionary history of a species or group. The phylogeny of a species can be determined based on the sequences of DNA. More closely related organisms will have more similar DNA.