Conservation of antisense RNA and their target genes in Bacteria Project in bioinformatics Conservation of antisense RNA and their target genes in Bacteria Pninit Shaked-Mishan Tal Kaminer

Antisense RNA in bacteria Antisense RNA are small diffusible trascripts that pair to target RNAs to control their biological functions. Definition of the problem: E.coli has small RNA molecules that regulate gene expression. We want to find out whether those molecules are conserved in other bacteria.

MicF RNA and his target gene OmpF: OmpF is a major E.coli outer membrane porin. MicF RNA inhibits OmpF expression in response to the environment. Unlike most other cases MicF and OmpF are partially complementary. The mechanism of inhibition is not completely clear. DicF and his target gene FtsZ: The FtsZ gene, which may be involved in initiation of division, is the target of several inhibitors including DicF RNA. Like the MicF case, DicF is only partially complementary to its target, the FtsZ mRNA and the DicF and FtsZ genes are unlinked.

Our tools: NCBI and PubMed For sequence search. Blast and Pairwise blast for sequence alignment and homology. RNA fold for structure prediction.

MicF RNA : Actagaataactcccgctatcatcattaactttatttattaccgtcattcatttctgaat E.coli ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| Actagaataactcccgctatcatcattaactttatttattaccgtcattcagttctgaat K.pneum Gtctgtttacccctatttcaaccggatgcctcgcat E.coli ||||||||||||||||||| ||||||||| |||||| Gtctgtttacccctatttcgaccggatgcttcgcat K.pneum Score = 167 bits (84), Expect = 2e-40 Identities = 93/96 (96%) Aaaacaaaaccttcactcgcaactagaataactcccgctatcatcattaactttatttat E.coli |||||| || ||||| ||||||||| |||| ||||||||||||||||||||||||||||| aaaacagaatcttcattcgcaactaaaatagtgaccgctatcatcattaactttatttat salmonella Taccgtcattcatttctgaatgtctgtttacccctatttcaaccggatgcctcgcattcg E.coli |||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||| taccgtcattcacttctgaatgtctgtttacccctatttcaaccggatgcttcgcattcg salmonella Score = 161 bits (81), Expect = 1e-38 Identities = 111/121 (91%)

MicF RNA Fold: K.pneumoniae E.coli Salmonella

OmpF gene : E.coli Other bacteria OmpF secondary structure: Conserved region

The blast results show no homology between DicF and other bacteria. DicF RNA and FtsZ gene: The blast results show no homology between DicF and other bacteria. Score = 1379 bits (717), Expect = 0.0 Identities = 1007/1152 (87%) E.coli Salmonella FtsZ gene: The gene is highly conserved in bacteria. It plays an important role in cell division.

Possible directions for future research: