Molecular Cloning

Definitions Cloning : Sub-cloning: Recombinant Plasmid : Obtaining a piece of DNA from its original source (Genome) and introducing it in a DNA vector Sub-cloning: Transfer of a cloned DNA insert or a part thereof from one vector to another vector Recombinant Plasmid : Vector into which foreign DNA was introduced Recombinant organism Organism with a recombinant vector

Why clone? Separate, identify, manipulate or express a specific DNA fragment 3

Step 1- Separate Two approaches: Fragment/digest genomic DNA Generates a vast number of fragments May be difficult to find fragment of interest PCR Amplification Much less fragments Much easier to find sequence of interest

DNA Replication & Amplification The Polymerase Chain Reaction

Polymerases Primer -OH 3’OH end Polymerase 5’…GTACT 3’…CATGAATGCTGCATTTGCGGGCATTACTC…5’ TACGACGTAAACGCCCGTAATGAG DNA or RNA Template

The Polymerase Chain Reaction-PCR Repetitive replication of a given region of DNA Allows the exponential amplification of a given region of DNA Increases the relative representation of the region of interest Allows the isolation of a given region of DNA 7

PCR-1st Cycle <3’GGAACGGTACCGT5’ Denaturation (95oC) Annealing of primers (Tm) <3’GGAACGGTACCGT5’ 5’CATACCGTGGGGTGCA………..ACGCGTTGCGATGGCA3’ 3’GTATGGCACCCCACGA………..TGCGCAACGCTACCGT5’ 5’CCGTGGGGT3’>

5’CATACCGTGGGGTGCA………..ACGCGTTGCGATGGCA3’ Extension (72oC) <3’GGAACGGTACCGT5’ 5’CATACCGTGGGGTGCA………..ACGCGTTGCGATGGCA3’ 3’GTATGGCACCCCACGA………..TGCGCAACGCTACCGT5’ 3’ 5’ --------------------------------  ----------------------------------  5’CCGTGGGGT3’> 9

PCR-2nd Cycle 3’ 5’ ---------------------------------- -------------------------------------- 5’ 3’ 3’ 5’ ---------------------------------- -------------------------------------- Denaturation -------------------------------  ----------------------------------  Annealing /Extension --------------- --------------

PCR-Subsequent Cycles Only this template is amplified exponentially: 2n times -------------------- ------------------- ------------------------ ------------------------ Yield: N=No(2n) N: Final number or mass No: Initial number or mass ------------------------ 32 times total

Problem You wish to amplify a 1kb sequence from 10ng of a 10 kb single stranded template with primers spanning positions 12-37 and 1007-1037. How many cycles are required to obtain 1µg of the desired product?

Solution Determine initial mass of desired product 10kb = 10ng therefore 1kb = 1ng or 10-3µg (Single stranded) Double stranded would be 2 X 10-3 µg Determine number of cycles starting from initial mass of desired product 1µg = 2 X 10-3µg(2n); solve for n Approx. 9 Determine number of cycles to obtain double stranded desired product 3 cycles Total: 9+3 = 12

Review of PCR Cycles PCR Primers: Short single stranded nucleotide sequences complementary to the targets 15-30 nucleotides Used in excess as compared to target to favor primer annealing rather than template self annealing

Review of PCR Cycles Annealing: Extension: Temperature at which primers anneal to complementary target sequences Must be below primer Tm Must be a temperature that allows both primers to anneal Usually between 55-75oC Extension: Carried out at temperature optimum for DNA polymerase Usually 72-75oC for Taq polymerase

Primers Characteristics: Short oligonucleotides complementary to sequences that flank the region of interest Establish the point of initiation of replication Establish the point of termination of replication 16

Primer Design 5’ complementarity 3’…………….ATGGGTATTGGCC…………………..-5’ Template CCATAACCGG-OH3’ 5’CGA 3’ complementarity 3’…………….ATGGGTATTGGCC…………………..-5’ Template TACCCATAACC TA-OH3’ 17

Primer Design 5’ 3’ 3’ 5’ 3’ 3’ Region of interest 3’ Correct orientation Wrong orientation 18

Primers 2 primers are required for exponential amplification Forward primer Primer whose sequence is the same as that of the template indicated Reverse primer Primer whose sequence is complementary to that of the template indicated Example 3’-GCGGTT••••••••••ATCGTTA-5’ Forward primer: ATTGCTA Reverse primer: CGCCAA

Problem 1- AAAAAA 2- TTTTTT 3- GGGGGG 4- CCCCCC 5’-AAAAAAAAAAAA GGGGGGGGGGGGG-3’ You wish to amplify the sequence represented by the box. Which primer pair represent the correct orientation to accomplish this? 1- AAAAAA 2- TTTTTT 3- GGGGGG 4- CCCCCC 20

Utility of PCR Amplification and isolation of a given region by changing its relative representation Between 100bp and 10Kpb Screening to determine the presence of a sequence of interest Presence or absence of an amplification product Site directed mutagenesis Used to add or remove nucleotides from the original template 21

Cloning Generate compatible ends DNA ligation Restriction Enzyme Appropriate vector Fragment of interest DNA Recombination Intermolecular ligation Recombinant Intramolecular ligation Non-Recombinant Transformation Host Cells Recombinant cell Non-Recombinant cell 1 plasmid/1 cell

Amplification of Recombinant Plasmids Duplication 1 colony= 1 clone with 1 plasmid + 1 insert Bacterial growth

Screening and Identification of Recombinant Plasmid clones Restriction mapping PCR