5. DNA Sequencing pp 379 - 381.

Slides:

Advertisements

Similar presentations

PCR-technique Applications by E. Börje Lindström This learning object has been funded by the European Commissions FP6 BioMinE project.

Advertisements

Lecture 1 Problem: From an E. coli cell extract, you assay enzyme activity for beta-galactosidase. You divide the extract into two samples, one of which.

Sequencing Using DNA dependant DNA polymerase Initiation & elongation commences Denature & anneal labelled primer * * dCTP dGTP dATP dTTPdCTP dATP dTTPdATP.

Principles of DNA Sequencing Terry Kotrla, MS, MT(ASCP)BB Spring 2010.

Biochemistry SSheng Zhao ( 赵晟 ), Biochemistry and Molecular Department of Medical school in Southeast University WWeb:

A Lot More Advanced Biotechnology Tools DNA Sequencing.

DNA sequencing Matt Hudson. DNA Sequencing Dideoxy sequencing was developed by Fred Sanger at Cambridge in the 1970s. Often called “Sanger sequencing”.

Chapter 19 (part 2) Nucleic Acids. DNA 1 o Structure - Linear array of nucleotides 2 o Structure – double helix 3 o Structure - Super-coiling, stem- loop.

PCR Polymerase Chain Reaction. PCR - a method for amplifying (copying) small amount of DNA in nearly any amount required, starting with a small initial.

DNA Sequencing. DNA sequencing … ACGTGACTGAGGACCGTG CGACTGAGACTGACTGGGT CTAGCTAGACTACGTTTTA TATATATATACGTCGTCGT ACTGATGACTAGATTACAG ACTGATTTAGATACCTGAC.

DNA Sequencing How do you do it?. DNA Sequencing DNA sequencing – used to determine the actual DNA sequence of an organism. Using a computer, one can.

Nucleotides and Nucleic Acids Part 2 (and a little bit from Chapter 9) Chapter 8.

DNA Sequencing. ? ? DNA extraction PCR Gel electrophoresis Insect identification ACAGATGTCTTGTAATCCGGC CGTTGGTGGCATAGGGAAAG GACATTTAGTGAAAGAAATTG ATGCGATGGGTGGATCGATG.

Workshop in Bioinformatics 2009 Class 2 Michal Linial Room A-515

DNA Sequencing Kabi R. Neupane, Ph.D. Leeward Community College ABE Workshop 2006.

DNA Sequencing Kabi R. Neupane, Ph.D. Leeward Community College ABE Workshop 2006.

DNA Sequencing.

Chapter 10 DNA Sequencing.

Sanger-Coulson Dideoxynucleotide Sequencing Kwamina Bentsi-Barnes Deisy Mendoza Jennifer Aoki Lecture 10/30/00 Best printed in color for clarity.

7.1 cont’d: Sanger Sequencing SBI4UP MRS. FRANKLIN.

DNA Sequencing. * Sequencing means finding the order of nucleotides on a piece of DNA. * Nucleotide order determines amino acid order, and by extension,

Automated DNA Sequencing LECTURE 7: Biotechnology; 3 Credit hours Atta-ur-Rahman School of Applied Biosciences (ASAB) National University of Sciences and.

DNA Sequencing Today, laboratories routinely sequence the order of nucleotides in DNA. DNA sequencing is done to: Confirm the identity of genes isolated.

1.) DNA Extraction Follow Kit Grind sample Mix with solution and spin Bind, Wash, Elute.

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

Manipulating DNA Genetic Engineering uses the understanding of the properties of DNA to study and change DNA sequences in living organisms – Invitro… in.

1 Purifying DNA & RNA Source Amounts & Purity Damage or Loss.

Cloning and genetic engineering by Ivo Frébort. Cloning Clone: a collection of molecules or cells, all identical to an original molecule or cell To "clone.

DNA sequencing: Importance Basic blueprint for life; Aesthetics. Gene and protein. –Function –Structure –Evolution Genome-based diseases- “inborn errors.

Announcements Lab notebooks due Monday by 5 No Ch. 9 Part 2 homework

Genomic sequencing in Plants R.Sakthivel

A Lot More Advanced Biotechnology Tools (Part 1) Sequencing.

1 Chapter 2: DNA replication and applications DNA replication in the cell Polymerase chain reaction (PCR) Sequence analysis of DNA.

Restriction Fragments and Mapping Restriction Fragment Analysis – System used to compare the genes and DNA sequences between individuals in a population.

DNA Sequencing Scenario

How DNA Sequence Is Determined? Polyacrylamide Gel Electrophoresis ATC 32 P AT 32 P A T A G C T A C G ATCG 32 P ATCGA 32 P ATCGAT 32 P ATCGATC 32 P ATCGATCG.

6.3 Advanced Molecular Biological Techniques 1. Polymerase chain reaction (PCR) 2. Restriction fragment length polymorphism (RFLP) 3. DNA sequencing.

Sequencing by the Sanger Dideoxynucleotide Chain Termination Method 1. Prepare replication template denature, add synthetic primer, promote annealing TAGGCGA.

©1999 Timothy G. Standish DNA Sequencing Timothy G. Standish, Ph. D.

Genomics Part 1. Human Genome Project  G oal is to identify the DNA sequence of every gene in humans Genome  all the DNA in one cell of an organism.

DNA Sequencing Mimi Chen & Joanne Kim

DNA Sequencing Mimi Chen & Joanne Kim

DNA Sequencing Sanger Di-deoxy method of Sequencing Manual versus Automatic Sequencing.

DNA Sequencing A population of DNA fragments is generated. –One end is common to all fragments (the 5’ end of the sequencing primer). –The other end terminates.

CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky Jackson © 2014 Pearson Education, Inc. TENTH EDITION CAMPBELL BIOLOGY Reece Urry Cain Wasserman Minorsky.

핵산 염기서열 분석(DNA SEQUENCING)

DNA sequencing DNA sequencing is the process of determining the precise order of nucleotides within a DNA molecule. It includes any method or technology.

DNA sequencing © 2016 Paul Billiet ODWS.

Restriction Fragments and Mapping

DNA Sequencing BCH 446.

Polymerase Chain Reaction (PCR)

DNA Sequencing Techniques

Di-deoxynucleotide Chain Termination

Genetic Research and Biotechnology

Sequencing Technologies

The Human Genome Project

DNA Sequence Determination (Sanger)

Screening a Library for Clones Carrying a Gene of Interest

UD. IV. GENÈTICA. Ll. IV. 5. Biotecnologia

DNA Sequencing A population of DNA fragments is generated.

DNA Sequencing A population of DNA fragments is generated.

DNA Sequencing A population of DNA fragments is generated.

Molecular Biology lecture -Putnoky

Polymerase Chain Reaction (PCR) & DNA SEQUENCING

Matthew 13:17 17 For verily I say unto you, That many prophets and righteous men have desired to see those things which ye see, and have not seen them;

Plant Biotechnology Lecture 2

SBI4U0 Biotechnology.

Introduction, Chemistry, Protocols & Troubleshooting

Polymerase Chain Reaction (PCR) & DNA SEQUENCING

A Lot More Advanced Biotechnology Tools

Presentation transcript:

5. DNA Sequencing pp 379 - 381

Fredrick Sanger Developed dideoxy termination sequencing method Nobel Laureate, 1980 Nobel Laureate, 1958; determined insulin sequence

DNA Sequencing The components of a sequencing reaction are:

dideoxyribose when both oxygen atoms removed deoxyribose when oxygen removed 3’ OH functional group necessary for DNA elongation

DNA Sequencing Four reactions are set up; one for each possible nucleotide. A G T C 15% dATP 25% dATP 25% dGTP 15% dGTP 25% dTTP 15% dTTP 25% dCTP 15% dCTP 10% ddATP 10% ddGTP 10% ddTTP 10% ddCTP

DNA Sequencing components in one test tube

DNA Sequencing DNA Sequencing Video

DNA Sequencing Contents of each tube is separated by gel electrophoresis Which type of gel medium is best suited for this method?

DNA Sequencing

DNA Sequencing

DNA Sequencing