PyroMark™ Q24 Andrea Tesoriero Application Specialist

Agenda Introduction Pyrosequencing technology Pyrosequecing workflow PyroMark Q24 Instrument System Software AQ workflow Mutation example – KRAS CpG Workflow

What is Pyrosequencing? Sequencing by Synthesis: Ronaghi M., Uhlén M., Nyrén P. (1998) Real-Time Pyrophosphate Detection for DNA Sequencing. Science 281:363-365 Sequence based technology in real time Simple and robust No separation, gel, label or probes In built controls Flexible in throughput in assay design in type of applications quantitation Pyrosequencing is a sequencing chemistry based on sequencing by synthesis. It doesn’t use dyes or labels or gels so doesn’t suffer from all the usual artifacts associated with sequencing chemistries. This makes it very accurate and very fast. Sequencing takes place in solution “in front of your eyes” ie in real time, you don’t run a reaction then a gel then analyse your results…it all happens simultaneously.

Pyrosequencing Assays Amplification of Region of interest (PCR) Pyrosequencing Analysis Sequencing primer PCR primer Region of interest Biotinylated PCR primer 4

Pyrosequencing Workflow PCR Sample Preparation – 10 min Pyrosequencing Analysis – 10-60 min/plate

Pyrosequencing Workflow PCR and Sample preparation 1. PCR with one of the primers biotinylated 2. Immobilize biotinylated PCR products onto streptavidin coated beads 3. Separate strands by denaturation in NaOH 4. Wash /neutralize the immobilized strand 5. Anneal sequencing primer 1-2 h 10-15 min Run Pyrosequencing 10-100 min

Pyrosequencing Workflow Sample Preparation Vacuum tool Water Washing buffer Denaturation Solution (NaOH) EtOH PSQ plate with sequencing primer PCR product immobilized on Sepharose beads

Pyrosequencing Workflow Sample preparation 1-24 post-PCR samples prepared in parallel in less than 15 minutes Minimal pipetting Actual hands-on time, less than 1 minute Plastic waste reduced to a minimum 8

Pyrosequencing Workflow Enzyme Cascade Time Light PPi ATP

Pyrosequencing Workflow A Pyrogram™ is generated

Pyrosequencing Workflow A Pyrogram™ is generated Variable Region GG TTT G C Reference Sequence

Pyrosequencing Workflow A Pyrogram™ is generated Sequence to Analyse = a/gCTGCCT Genotype = A/G Heterozygote Double height ref peak Single height ref peaks 2 half height peaks C A G T C T G C T Negative controls Reference Peaks

Pyrosequencing Workflow Unequivocal genotype classification ACTGCCT -------- TGACGGA--- Homozygous A ACTGCCT -------- TGACGGA--- A G C T GCTGCCT -------- CGACGGA--- Homozygous G GCTGCCT -------- CGACGGA--- A G C T A G ACTGCCT -------- TGACGGA--- Heterozygous A/G GCTGCCT -------- CGACGGA--- A G C T

PyroMarkTM Q24 A Small Smart Affordable Pyrosequencing System with a 24 well plate format A complete solution for Mutation and Methylation Analysis CpG methylation Allele quantification Mutation analysis 14

PyroMark™ Q24 Instrument Design X-Y drive Positioning A C G T Reagent cartridge Ink jet delivery 24 well plate Mixer and thermostat Instrument design This is a technical drawing of the interior instrument design and shows the position of reagent cartridge, plate and CCD camera Key things to describe: An X-Y drive moves the reagent cartridge over the plate Dispensation of reagents by ink jet delivery in all wells The 96 well plate is placed in a thermostatted heating block housed on top of a shaker table for efficient mixing of reagents and beads in the wells Detection of the light in all wells allows for simultaneous monitoring of the sequencing events in all wells, thus real time sequencing. 24 individual CCD Chips Detection

PyroMarkTM Q24 System Reagents Application and Assay Design software Instrument Vacuum Prep. Workstation

PyroMark™ Q24 Benefits An extremely easy to use system - Up to 24 samples in parallel Small Footprint Takes very little bench space Measuring only H420xW390xD525mm Robust Can be run at ambient temperatures between 15°C and 32°C. Runs can be set up and analyzed on any PC anywhere, running PyroMark™Q24 Software. Information is transferred between the instrument and computer via a USB memory stick. Conforms to EU IVDD so suitable for clinical use in Europe

PyroMark™ Q24 Software The software has two analysis modes: AQ - A variety of quantification studies and SNP analysis. CpG - Methylation analysis of multiple consecutive CpG sites. AQ assays and CpG assays can be performed on the same PyroMark™ Q24 Plate. 5 multi licenses You can toggle between the analysis modes in the analysis view of the software, by selecting AQ or CpG in the toolbar. Both modes offer detailed report information that can be exported to html, Excel, text and PDF formats. 18

PyroMark™ Q24 software AQ mode Frequency calculations of variable positions in sequence context including; Single variable position AG/TC Multiple variable positions AG/TCAG/TCAG/T/AC Di- Tri- or Tetra-allelic mutations GA/C/G/TA High resolution of individual sites Quality assessment of individual sites and sequence context SNP analysis (Multiple positions, Di- Tri- or Tetra-allelic variants) Analysis of SNPs in the presence of CpG sites

Mutation example KRAS Mutations in the KRAS gene results in a constitutively active KRAS protein which leads to abnormal cell growth, proliferation and differentiation. KRAS is frequently mutated in Colorectal cancer Lung cancer The most common KRAS mutations are found in codons 12,13 and 61 In several types of cancer the K-Ras gene is mutated, resulting in a loss of activity regulation and subsequently increased invasion and metastasis, and decreased apoptosis. The highest frequency of mutated KRAS is found in pancreatic cancers (90%), but in colorectal and lung cancers up to 30% of the patients have mutations in KRAS. Characteristic for these cancers are that they are adeoncarcinoma (originate form adenovirus infections). The most common mutations in KRAS are found at residue G12 and G13 in the P-loop and the catalytic residue Q61.

Mutation example KRAS – mutation frequency Codon 12+13 Codon 61 = Guanine 7477 70 G = Thymine T = Cytosine C = Adenine A Basepair substitution Basepair substitution Flexible assay design facilitates analysis of contiguous, multivariable mutations Wt seq G G T G G C C A A Codon 61 FP FPB Seq RPB RP GGT GGC GTAGG TCCA GTT CTC Codon 12 & 13 PyroMark Q96/Q24 KRAS v2.0 test is an assay for mutation analysis of KRAS; optimized for use on any Pyrosequencing instrument. The most frequent SNPs in KRAS codons 12, 13 and 61, resulting in amino acids exchange, is illustrated in the histogram. However, other rare mutations resulting in a aminoacid exhange is also reported, but the relevance of these are not known. PyroMark Q96/ Q24 KRAS v2.0 test assay is designed to amplify the two DNA regions in the KRAS gene where the most frequent mutations are found. The PCR results in a ≈120bp amplicon which is more than half the size compared to the previous assay. In paraffin embedded tissues the DNA is often degraded in pieces about 200 bp. The new primers improve the PCR and ensure high quality sequence data. The codons 12+13 analysis is designed as an forward assay while the assay for codon 61 is designed in reverse order. Assays performed according to the ”Instructions for use” enables detection of nucleotide substitutions in position and 2 of codons 12 and 13 and position 3 in codon 61. In addition, post-run analysis of peaks in an Excel macro enables identification of rare mutations in the codons. Quantification of these mutations can be performed on MD and ID instruments by running a new sample with changed ”Sequence to Analyze”. PyroMark Q24 application software contains a function that post run enables quantification of rare mutations by just changing the sequence to analyze in the run-file.

Mutation example The KRAS 2.0 assay Codons 12 13 61 Wt seq G C T C A A C T A Multi-variable mutations C T G C G C T G A C T BND FP Seq RPB NNt RVc Codon 12 & 13 Codon 61 FPB RP

Mutation example The KRAS 2.0 assay Efficient detection and quantification of mutations in codons 12, 13 and 61 with built in quality control 1 well/sample for all Codon 12 & 13 mutations (9 reported mutations) 1 well/sample for all Codon 61 mutations (7 reported mutations) Provides high quality data of DNA from fresh, frozen and paraffin-embedded tumor samples Sequence context provides built-in control and eliminates false positives/negatives

Mutation example The KRAS assay – Wild Type

Mutation example The KRAS assay – codon 12 position 2 GGT>GCT Gly12Ala GGT>GAT Gly12Asp GGT>GTT Gly12Val

Mutation example The KRAS assay – codon 12 position 1 GGT>TGT Gly12Cys GGT>AGT Gly12Ser

Mutation example The KRAS assay – codons 13 and 61 GGC>GAC Gly13Asp CAA>CAC Gln61His TTG>GTG

Mutation example The KRAS assay – Conclusions 1 PCR to cover ALL mutations in codons 12 & 13 Minimises amount of gDNA needed (10ng) Optional second PCR to cover all mutations in codon 61 Provides results for rarer but important mutations not covered by other methods Fast results PCR product to quantitative result in ~ 30 minutes for 24 samples

CpG methylation analysis mC C 1. Bisulfite conversion 2. PCR amplification 3. Pyrosequencing C U C C U T 25% 75% Degree of methylation is automatically analyzed by the software. mC C

CpG methylation analysis Assay design CpG island Sequencing primer PCR primer CpG sites PCR primer All primers are located in non-variable regions, in between CpG sites Enables analysis of several adjacent CpG sites with one sequencing primer Freedom in positioning of the sequencing primer distance from CpG site orientation of assay The primer placement for Pyrosequencing analysis is flexible, unlike competitors like MSP, SnapMeth, COBRA

CpG methylation analysis A range of analysis possibilities Any single CpG site Multiple consecutive CpG sites One gene at a time Several genes in the same analysis (analyze up to 24 different assays in one run)

Benefits of Pyrosequencing for CpG methylation analysis Quantitative analysis of multiple consecutive sites Flexible assay design Forward – reverse/ Upper – lower Flexible primer positioning Built-in Bisulfite treatment control Excellent Performance Accuracy Precision Reproducibility over time Confidently discern even small changes in methylation Fast results

Benefits of Pyrosequencing for CpG methylation analysis Built-in quality control of bisulfite treatment RASSF1A gene Before bisulfite treatment (RASSF1A) No separate reaction needs to be run to ensure complete bisulfite conversion. Every single well will contain a built-in control. CCGACATGGCCCGGTTGGGCCCGTGCTTCGCTGGCTTTGGGCGCTAGCAAGCGCGGGCCGGGCGGGGC Analyzed sequence TYGATATGGTTYGGTTGGGTTYGTGTTTYGTTGGTTTTGGGYGTTAGTAAGYGYGGGTYGGGYGGGGT Any C not followed by a G gives bisulfite QC

Benefits of Pyrosequencing for CpG methylation analysis Accuracy - Linear response in measured methylation Normal DNA Colon cancer DNA This is illustrating how accurate the analysis is – a perfectly linear relationship was observed in this experiment. Linear response of methylation measured by Pyrosequencing in PCR-amplified products generated from controlled dilutions of in-vitro methylated (IVM) genomic DNA with unmethylated DNA (IVM DNA is 80% methylated). Sequence to analyze: GGGTGGGGYGGATYGYGTGYGT

Methylation levels are consistent even when using different primers Benefits of Pyrosequencing for CpG methylation analysis Accuracy – using different sequencing primers Methylation levels are consistent even when using different primers Seq. Primer 3 Seq. Primer 2 Seq. Primer 1 MLH1 gene A region of 73 bases, containing 12 CpG sites, was analyzed using 3 different sequencing primers. All values above are based on the average of 3 replicates. Note how well the methylation values correlate, regardless of primer. 73 bases Each methylation value is the mean of 3 replicates

Benefits of Pyrosequencing for CpG methylation analysis Consistent precision among CpG sites Confidently measure the individual degree of methylation in adjacent CpG sites, even at long distances from the sequencing primer Pos. 1 Pos. 2 Pos. 3 Pos. 4 Pos. 5 Pos. 6 Pos. 7 Pos. 8 Pos. 9 Pos. 10 MGMT gene Does the distance from the sequencing primer affect the precision of methylation results? The standard deviation of the 10th site is just as low as that of the first site from the sequencing primer. (Based on replicate Pyrosequencing, not replicate PCR.)

Benefits of Pyrosequencing for CpG methylation analysis Quantification of individual CpG sites Methylation levels may vary from site to site Pyrosequencing detects site variation reproducibly This experiment shows The reproducibility of methylation analysis using Pyrosequencing The importance of analyzing several, consecutive CPG sites. Using other methods, that just look at one single CpG position, one might get a non-representative value (site number 2 in this experiment serves as a good example). The relevance of these variations are yet unknown. Shaw et al (2006) discusses this phenomena, and it might be due to steric hindrance of the methylating enzymes. Nevertheless, this shows the importance of analyzing multiple, consecutive sites. (Values based on repeated Pyrosequencing and repeated PCR.) Methylation pattern in RASSF1A in neighboring CpG sites in 4 tumor samples (duplicate runs)

Imprinting Gene expression dependent on the parent of origin Prader-Willi Syndrome (PWS) Angelman Syndrome (AS) Neuro developmental disorders caused by a deficiency with 15q parental contributions methylated on the maternal chromosome remains unmethylated on paternal chromosome PWS: lack of paternal contribution paternal deletion (70%) maternal uniparental disomy (25%) AS: lack of a maternal contribution maternal deletion (70%) paternal uniparental disomy (5%) In particular they looked at two pediatric disease in neuro development, Prada Will Syndrome and Angelman syndrome. In PWS, there is a lack of paternal contribution and this can occur in two ways-paternal deletion or receiving two copies of the maternal allele (known as uniparental disomy). AS is the exact opposite-lack of maternal contribution (UPD-receive two copies of a chromosome from one parent) 38

Benefits of Pyrosequencing for CpG methylation analysis Flexible assay design Analysis in either direction – Prader Willi/Angelman Forward assay: C/T Note how well the results achieved forward/reverse correlate to each other. The first site from left (upper pyrogram) corresponds to the first site from right (lower pyrogram). Reverse assay: G/A

Software Overview

PyroMark™ product line Cancer mutations, methylation, clinical genetics Genetic tests that show real sequence information. PyroMark RUO Optimized PCR and Pyrosequencing protocols, built-in quality control Cancer Mutations: KRAS, BRAF CpG Methylation: p16, MLH1, LINE-1, MGMT Clinical Genetics: APOE, HFE, MTHFR, Prader-Willi/Angelman PyroMark Assay Database over 1,000 optimized & wet-tested assay designs Continuous updates Online access: www.pyrosequencing.com/techsupport 41

PyroMark product line Reagents Assay Kits Software Instruments Product Offering Overview Reagents Assay Kits Software PyroMark Q96 MD Instruments PyroMark Q96 ID PyroMark Q24 Workstation Sample preparation PyroMark Q24

Genetic Variation SNP & mutation analysis Simplex & multiplex SNP genotyping Tri/tetra-allelic mutations Quantification CpG methylation analysis Analysis of polyploid genomes Allele-specific gene expression SNP pooling studies Viral/bacterial load Loss of heterozygosity Gene copy number Short DNA sequencing Microbial identification Species discrimination Sub-typing Resistance detection Sequence signatures DNA bar-coding Sequence variation Sequence verification Forensics Clone checking

Gracias por su atención