Influence of postbiotic RG14 and inulin combination on cecal microbiota, organic acid concentration, and cytokine expression in broiler chickens K. Y. Kareem, T. C. Loh, H. L. Foo, S. A. Asmara and H. Akit 2016 Poultry Science 0:1–

 Antibiotic-resistant genes Introduction Vancomycin resistant Enterococci

 The government-commissioned report last year estimated 10 million people a year could die worldwide by 2050 because of the rise of “superbugs” A strain of bacteria that has become resistant to antibiotic drugs  The threat to human health has been compared to climate change and nuclear war

 Natural feed additives  Metabolites produced by LAB known as postbiotic

 Why postbiotic Most of the immunomodulatory activities of bacteria are associated to their metabolites Safer: no harmful bacteria components Host reproducibility: no need of bacterial growth or colonization Efficacy: higher concentration of active components

 In vitro studies P. acidilacticiE. coliSalmonella enterica L. monocytogenese Vancomycin-Resistant Enterococci (VRE)

 Genomic Cecal DNA extraction  Bacterial quantification was conducted according to the method described by Bahman et al. (2012)  DNA isolated by QIAamp DNA stool kit (Qiagen, Hilden, Germany)  The populations of total bacteria, Lactobacillus spp, Enterococcus spp, Enterobacteria spp, E. coli, Bifidobacteria spp and Salmonella spp. were analyzed by qPCR. Materials and Methodology  Broiler performance

Table 1:The sequence of primers used targeting total bacteria, Lactobacillus, Bifidobacteria, Enterococcus, Enterobacteriaceae, E.coli and Salmonella Target bacteriaSequence 5’-3’ Annealing temperature (˚C) References Total bacteria F-CGGCAACGAGCGCAACCC R_CCATTGTAGCACGTGTGTTAGCC 55 Jahromi et al. (2013) Lactobacilli F-CATCCAGTGCAAACCTAAGAG R_GATCCGCTTGCCTTCGCA 58 Wang et al. (1996) Bifidobacteria F-GGGTGGTAATGCCGGATG R_TAAGCCATGGACTTTCACACC 60 Bartosch et al. (2004) Enterococcus F-CCCTTATTGTTAGTTGCCATCATT R_ACTCGTTGTACTTCCCATTGT 60 Navidshad et al. (2012) Enterobacteriaceae F-CATTGACGTTACCCGCAGAAGAAGC R_CTCTACGAGACTCAAGCTTGC 60 Navidshad et al. (2012) E.coli F-GTGTGATATCTACCCGCTTCGC R_AGAACGCTTTGTGGTTAATCAGGA 60 Frahm and Obst (2003) Salmonella F-TCGTCATTCCATTACCTACC R_AAACGTTGAAAAACTGAGGA 55 Nam et al. (2005)

Volatile fatty acid (VFA)  VFA contents in the cecum was determined using gas chromatography (GC) as described by Thanh et al. (2009)

Gene expression from ileum RNA Extraction cDNA Synthesis Real-Time PCR

Results

Table 2: Effects of different levels of postbiotic and inulin combination on BW, BWG, FI and FCR on broiler chickens Dietary treatments 1 P –values Parameter negative control positive control T1T2T3T4SEMLinearQuadratic BW (g) b b a ab a b BWG (g) b b a ab a b FI (g) FCR (g:g) 1.89 a 1.86 ab 1.77 b 1.80 ab 1.88 a abc Means ± SEM. Means with different superscripts in the same row are differ significantly (P< 0.05). 1 negative control: basal diet feed, positive control: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% Inulin), T4: (0.6% RG14+1.0% Inulin)

Table 3: Effect of different levels of postbiotic and inulin combination on caecal microbial population of broiler chickens abcd Means ± SEM. Means with different superscripts in the same row are differ significantly (P< 0.05). 1 negative control: basal diet feed, positive control: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% Inulin), T4: (0.6% RG14+1.0% Inulin) Log 10 copy no./ml DNA extract Dietary treatments 1 SEM P –values negative control positive control T1T2T3T4LinearQuadratic Total bacteria9.40 c 9.73 ab 9.89 ab 9.85 ab 9.96 a 9.64 bc <.0001 Lactobacillus spp Bifidobacteria spp5.46 c 5.55 c 6.16 ab 6.38 a 5.79 bc 5.73 c <.0001 Enterococcus spp Enterobacteria spp6.23 a 5.33 cd 5.65 bc 5.74 b 5.26 d 5.42 bcd 0.06< E. coli7.23 a 7.22 a 5.73 c 6.48 b 6.34 b 5.22 d 0.10<

Table 4: Caecal digesta VFA in broiler chickens fed with different levels of postbiotic and inulin ab Means ± SEM. Means with different superscripts in the same row are differ significantly (P< 0.05). 1 negative control: basal diet feed, positive control: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% Inulin), T4: (0.6% RG14+1.0% Inulin) Parameter (mM) Dietary treatments 1 SEM P –values negative control positive control T1T2T3T4LinearQuadratic Acetic acid53.74 b a a ab ab a Propionic acid Butyric acid Total

Figure 1: Effect of different levels of postbiotic and inulin on expression of IL-6, IL-8, IFN and TNF-α in the ileal tissue Treatments: 1 negative control: basal diet feed, positive control: basal diet feed+ neomycin and oxytetracycline, T1: (0.15% RG14+1.0% inulin), T2: (0.3% RG14+1.0% inulin), T3: (0.45% RG14+1.0% Inulin), T4: (0.6% RG14+1.0% Inulin).Bars with no common letter differ significantly (p< 0.05).

Conclusion Supplementation of combinations in the diet of broiler chickens improved growth performance, population of beneficial bacteria, reduced the population of Enterobacteria and E. coli, and increased acetic acid concentration with associated alterations in ileal cytokine expression. Treatments with 0.15% and 0.45% RG14 displayed the best results, especially in terms of growth performance, cecal total bacteria, and cytokine expression Economically, postbiotic RG14 supplementation, 0.15% is preferred to be used as an optimal level. Postbiotic and inulin combinations are potential replacements for AGP in the poultry industry

18 Inhibitory activity against VRE by using 60 and 100 μL (MAU/ml) = * diameter of zone (mm) Volume of postbiotic (mL) The highest dilution factor (MAU/ml) = * 14 = (MAU/ml) = * 12 = μL 60 μL