Use of SNP-DNA analysis in authenticating Basmati rice

Slides:

Advertisements

Similar presentations

An Introduction to the application of Molecular Markers

Advertisements

Use of SNP-DNA analysis in authenticating Basmati rice.

Analysis of gene expression by real-time PCR RBCS3 and Cab-1b transcript quantitation by real time PCR.

Mass Spectrometry Separation principle: A particle with a certain mass (m) and a certain charge (z) behaves in a predictable manner when exposed to a electromagnetic.

Mass Spectrometry in the Biosciences: Introduction to Mass Spectrometry and Its Uses in a Company Like Decode. Sigurður V. Smárason, Ph.D. New Technologies.

SNPs Human Genome. SNP Typing Allele specific hybridization ASO probes usually with the polymorphic base in a central position in the probe sequence.

Introduction to DNA.

Genomic DNA purification

The polymerase chain reaction (PCR) rapidly

Analysis of Norwegian BRCA mutations using Sequenom MALDI TOF MS Ann Curtis on behalf of James Eden Institute of Human Genetics Newcastle University.

Biotechnology and Recombinant DNA

Single Nucleotide Polymorphisms Mrs. Stewart Medical Interventions Central Magnet School.

13-1 Changing the Living World

Progression of DNA Typing Markers

Chapter 15 New Technologies and Automation ©2002 Academic Press.

PCR Forensics. Today’s Lab There has been an outbreak of Salmonella poisoning in the Student Union cafeteria at Stanford University cafeteria. You have.

 The process by which desired traits of certain plants and animals are selected and passed on to their future generations is called selective breeding.

DNA-Based Identifications of Tilapia in Hawaii College of Tropical Agriculture and Human Resources University of Hawaii at Manoa Jinzeng Yang and Harry.

Chapter 9: Genetic Engineering

Taqman Technology and Its Application to Epidemiology Yuko You, M.S., Ph.D. EPI 243, May 15 th, 2008.

Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.

The Polymerase Chain Reaction (DNA Amplification)

Polymerase Chain Reaction (PCR) Nahla Bakhamis. Multiple copies of specific DNA sequences; ‘Molecular Photocopying’

Amplification of a DNA fragment by Polymerase Chain Reaction (PCR) Ms. Nadia Amara.

Using a Single Nucleotide Polymorphism to Predict Bitter Tasting Ability Lab Overview.

Crime Scene Investigator PCR Basics™

RECOMBINANT DNA DNA THAT CONTAINS DNA SEGMENTS OR GENES FROM DIFFERENT SOURCES. DNA TRANSFERRED FROM ONE PART OF A DNA MOLECULE TO ANOTHER, FROM ONE CHROMOSOME.

Chapter 8 Additional DNA Markers: Amelogenin, Y-Chromosome STRs, mtDNA, SNPs, Alu Repeats ©2002 Academic Press.

Polymerase Chain Reaction (PCR). What’s the point of PCR? PCR, or the polymerase chain reaction, makes copies of a specific piece of DNA PCR allows you.

PCR Polymerase Chain Reaction PCR Polymerase Chain Reaction Marie Černá, Markéta Čimburová, Marianna Romžová.

Chapter 13 Genetics and Biotechnology 13.1 Applied Genetics.

Arun Kumar. B M.Sc 1st Year Biotechnology SSBS

Data Quality Control.

Biogenetic Engineering

MALDI-TOF MS Bergdís Björk Bæringsdóttir Daníel Arnar Tómasson

The is a Critical Resource for Developing and Refining Trait-Predictive DNA Tests Cameron Peace, Daniel Edge-Garza, Terry Rowland, Paul Sandefur.

Genetic Engineering.

SNPs in forensic genetics: a review on SNP typing methodologies

Starter Complete the quiz and hand in..

S. Emonet, H.N. Shah, A. Cherkaoui, J. Schrenzel

UNIT VII – GENOMICS & CANCER

PCR uses polymerases to copy DNA segments.

Chapter 20 – DNA Technology and Genomics

Single Nucleotide Polymorphisms

Screening a Library for Clones Carrying a Gene of Interest

Time-of-Flight Mass Analyzers

Biogenetic Engineering

High-Throughput, Multiplex Genotyping Directly from Blood or Dried Blood Spot without DNA Extraction for the Screening of Multiple G6PD Gene Variants.

PCR -PCR replicates (or amplifies) the DNA many times so that a large enough sample can be analyzed.

Sequencing and Copying DNA

The Polymerase Chain Reaction (PCR): Replicating DNA in the Test Tube

Rapid Genotyping of Single Nucleotide Polymorphisms Influencing Warfarin Drug Response by Surface-Enhanced Laser Desorption and Ionization Time-of-Flight.

DNA and the Genome Key Area 8a Genomic Sequencing.

PCR uses polymerases to copy DNA segments.

S. Emonet, H.N. Shah, A. Cherkaoui, J. Schrenzel

PCR uses polymerases to copy DNA segments.

Andrea Gaedigk, Amanda K. Riffel, J. Steven Leeder

Identification of Bacteria BBT203 Ach

Introduction to Polymerase Chain Reaction (PCR)

PCR Polymerase chain reaction (PCR)

PCR uses polymerases to copy DNA segments.

9-3 DNA Typing with Tandem Repeats

Changing the Living World

PCR uses polymerases to copy DNA segments.

PCR uses polymerases to copy DNA segments.

General schematic for MS analysis of ionized microbiological isolates and clinical material. General schematic for MS analysis of ionized microbiological.

Biological Mass Spectrometry

PCR uses polymerases to copy DNA segments.

Presentation transcript:

Use of SNP-DNA analysis in authenticating Basmati rice From waaay back in 2006 …with a font that was fashionable then

Single nucleotide polymorphisms Single nucleotide differences exist between individuals, plant and animal varieties and bacterial strains TCGAAATGCATGCGCATGATT Variety 1 TCGAAATGCATGCGCGTGATT Variety 2

Assaying SNPs by MALDI-ToF MS Once a SNP is identified, 3 primers are required to enable genotyping including:- - Two PCR primers to amplify the region around the SNP 5’ 3’ - One Extension primer which anneals directly adjacent to the SNP. 5’ 3’

Assaying SNPs by MALDI-ToF MS TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT Anneal primer TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TTACGTACGCG +polymerase +ddNTP’s TCGAAATGCATGCGCATGATT TCGAAATGCATGCGCGTGATT TTACGTACGCGT TTACGTACGCGC Analyse extension products by MALDI-TOF MS

MALDI-TOF Mass Spectrometry Electric potential across the flight tube to the detector. Larger ions take longer to fly. This Time of Flight (ToF) allows the separation of ions on the basis of size. Samples spotted onto a MALDI plate Nitrogen laser (337nm) vaporises and ionises the sample.

Difference in peak size reveals the SNP allele for that rice variety Assaying SNPs by MALDI-ToF MS C = 273 Da T = 288 Da A = 297 Da G = 313 Da Difference in peak size reveals the SNP allele for that rice variety Unextended SNP primer Extended SNP primer

Multiplexing SNP assays

Quantitative SNP assays

MALDI-TOF-based DNA authentication of basmati rice Sponsored by the FSA

FSA sponsored work includes:- Completing a SNP database for the main commercial varieties and their adulterants. Assessing the reproducibility of the protocols to determine the uncertainty of the method. Performing a limited survey of Basmati Products being sold in UK supermarkets. Developing a Standard Operating Procedure

Basmati rice varieties Traditional breeds Basmati 386 Basmati 370 Dehradun Ranbir Basmati Taraori (HBC-19) Hybrid Basmati 385 Super Basmati Pusa Basmati Kasturi Basmati 198 Common Adulterants Pusa 169 Sabarmati PR 106 Kali-much Lakra Saket 4 Parimal Sherbati Terricot

Assembling a SNP database for Basmati varieties and adulterants

Examples of survey work

SNP Genotyping using primer I Primer + C Primer + T Tilda basmati Rice ASDA basmati rice

SNP Genotyping using 11 primers Tilda basmati rice behaves like traditional variety Kernal Asda basmati rice suggests another hybrid: Pusa

SNP analysis as a QC tool Plausible contamination / mixture (S + T = 2003) ?

from mixing (or crossing) SNP analysis as a QC tool New SNP marker alleles Revealed that the 2003 crop could NOT have arisen from mixing (or crossing) Super Basmati (S) with Thai (T) rice

HumanOmniExpress-24 BeadChip Number of Markers >713,014 HumanOmniExpress-24 BeadChip Zoom ahead to 2012 Manhattan plot of association with cilantro soapy-taste from 14,604 unrelated participants