Use of CRISPR/Cas to edit the Arabidopsis Na+/H+ Antiporter NHX1 Huy Thai, Elias Bassil, and Eduardo Blumwald Department of Plant Sciences, University of California Davis Introduction Na+/H+ antiporters (NHXs) are integral membrane proteins residing on the plasma membrane and in intracellular compartments including the vacuole, Golgi and trans-Golgi network (Fig 1 & Fig 2). NHXs are implicated in salt tolerance, ion homeostasis, vesicular trafficking and diverse aspects of development. Recently the use of CRISPR/Cas (Clustered Regularly Interspaced Short Palindromic Repeats) and the associated RNA guided endonuclease Cas (CRISPR-associated) has been used successfully as a novel gene-editing technique but in limited studies in plants. Here we applied this technique to create a knockout of the vacuolar NHX1 antiporter, for use in reverse genetic studies. Aim Create an expression vector that will target a 23bp sequence of NHX1 for CRISPR/Cas9 Transform wild type (col0) and nhx2/nhx3/nhx4 triple knockout An nhx1 single knockout and the tetra knockout nhx1/nhx2/nhx3/nhx4 should be created. Select positive transformants by antibiotic resistance; genotype using PCR for NHX1 transcript and phenotype the knockouts by comparing the growth and development to wild type and other nhx knockouts. Method 1. Generation of guide RNAs. Selected two protospacers (23bp each) in the 1st exon of AtNHX1 genome of Arabidopsis (Fig 3). Protospacer 1 sequence: GACATCTGATCACGCTTCTGTGG. Protospacer 2 sequence: CTTTGTGCTTGTATTGTTCTTGG 2. Generation an entry clones a. Each protospacer was cloned into the Pen-Chimera vector to generate the entry clone (Fig4). b. Using Gateway® reactions, expression clones in the pDe-Cas9 GenR backbone were created from the entry clones (Fig 4). c. Transform the expression vector into Agrobacterium. 3. Generation of Agrobacterium strains Transform Agrobacterium strain GV3101 with both expression vectors via electroporation and select on media (Rif/Gent/Spec) for positive colonies. Transform wild type (Col0 ecotype) and the triple knockout nhx2nhx3nhx4 with each Agrobacterium and obtain T1 seeds. 4. Selection of positive transgenic plants a. Screen for resistant T1 plants grown under gentamicin selection. 5. Genotype and Phenotype selected plants. The expected phenotype of the two resulting plants should be similar to nhx1 and nhx1nhx2nhx3nhx4 T-DNA insertion knockouts (Fig 5). Summary Currently, we are selecting transgenic lines. We expect positive transformants to exhibit either the single knockout nhx1 phenotype (transformation of wild type) or the tetra knockout nhx1nhx2nhx3nhx4 (transformation of the triple knockout nhx2nhx3nhx4). Such results would validate the utility of using CRISPR/Cas9 system in genomic editing of NHX antiporters of Arabidopsis. Col0 nhx1 nhx2/3/4 nhx1/2/3/4 CRISPR/Cas gene editing Figure 3: Description of the CRSPR/ Cas9 gene editing technique Guide RNA uses 20 nucleotides plus an adjacent motif (NGG) termed a “protospacer” to direct nuclease to make a double stranded break creating a non-homologous end join. Has >70% Target efficiency Figure 5: Phenotypes of nhx T-DNA insertion knockouts. Top row indicates phenotypes at 7 weeks and bottom row indicates 3 weeks after planting. We expect that editing of NHX1 wild type (Col0) and the T-DNA knockout nhx2/3/4 using CRISPR/Cas described here should result in phenotypes resembling nhx1 and nhx1/2/3/4 respectively. From systembio.com CRISPR/Cas9 is the new biological breakthrough that was first published in 2013 (Feng, et al. 2013). The system takes advantage of a bacterial adaptive immune response against viral infection. The protein (nuclease) Cas9 is CRISPR associated-protein that can guide the system directly to eliminate a specific gene or to introduce a new gene into the genome. References: Bassil, E., et al. (2011) Plant Cell, 23, 3482–3497. Bassil, E., et al (2011) Plant Cell, 23, 224-239. Blumwald, E., et al. (1999) Plant Science, 18,227-255. Fauser, F., et al. (2014) The Plant Journal, 79, 348–359. Feng, Z., et al. (2013) Cell Res. 23, 1229–1232. Jinek, M., et al. (2012) Science, 337, 816–821. Contact: Huy Thai Department of Plant Science University of California, Davis, CA 95616 Ph: 408-239-9536 Email: hqthai@ucdavis.edu Figure 1: Cellular localization of the family of NHX antiporters in Arabidopsi Figure 2: Amino acid sequence-based clustering of the eight Arabidopsis NHX isoforms. The analysis indicates that the isoforms cluster into three subgroups: vacuolar, endosomal/vesicular and plasma membrane. Gateway cloning strategy Conclusion So far we have successfully generated the entry clone that contain pEn-Chim-Protospacer I and pEn-Chim-Protospacer II, generated the expression clone pDe-Cas9-Protospacer I and pDe-Cas9-Protospacer II, and successfully transformed the two vectors into Agrobacteria strain GV3101. Acknowledgements Professor Blumwald (Principal Investigator), Dr. Elias Bassil, Dr. Hiromi Tajima, Shiqi Zhang. Department of Plant Sciences, University of California, Davis. Tammy Hoyer and Enid Picart, Undergraduate Research Center; Raynell Hamilton, MURAL Program Goal Generate a tetra knockout nhx1nhx2nhx3nhx4 in Arabidopsis lacking all four vacuolar-localized NHX-type Na+/H+ antiporters using the Clustered Regularly Interspaced Short Palindromic Repeats (CRISPR/Cas9) gene-editing technique. Figure 4. Gateway Reaction s used to generate the expression clone Gateway method uses two recombination reactions to generate expression clone s. (pDe-Cas9-protospacer1 and pDe-Cas9-protospacer2).