Table E1 – Sequences of primers used in qPCR experiments

Slides:



Advertisements
Similar presentations
A B pre neg. pre-miR-92apre neg.pre-miR-92a n.s. SMC apoptosis (OD 450 nm) EC apoptosis (OD 450 nm) n.s. Figure S1: pre-miR-92a does not influence vascular.
Advertisements

GeneEnsembl Gene IDPrimer sequenceAmplicon size(BP) DDAH1ENSMUSG Forward (5'to 3') CCCAGCAAAGGGCATGTC Reverse (5' to 3') CCATCTCCGAGTTGCTCACA.
Signal regulatory protein-α interacts with the insulin receptor contributing to muscle wasting in chronic kidney disease  Sandhya S. Thomas, Yanjun Dong,
TNF-α- Mediated-p38-Dependent Signaling Pathway Contributes to Myocyte Apoptosis in Rats Subjected to Surgical Trauma Cell Physiol Biochem 2015;35:
Vasopressin and noradrenaline reduce LPS-induced monocyte TNF release
Simvastatin modulates chemokine and chemokine receptor expression by geranylgeranyl isoprenoid pathway in human endothelial cells and macrophages  Niels.
Fig. 1. Treatment with S. japonicum cercariae resulted in reduced susceptibility to DSS-induced colitis in mice. Mice were infected with 20±2 S. japonicum.
BAY , a novel MNK1 inhibitor, targets oncogenic protein expression and shows potent anti-tumor activity  Susann Santag, Franziska Siegel, Antje.
Figure 6. The effect of GV1001 on ENO1-induced pro-inflammatory cytokine production in RA PBMCs. RA PBMCs were pre-treated with GV1001 (100 µM) for 1 h.
Inflammatory cytokines in acute renal failure
Volume 70, Issue 8, Pages (October 2006)
Supplementary materials
by Xiao Z. Shen, You Li, Liang Li, Kandarp H. Shah, Kenneth E
William H. D. Hallett, Weiqing Jing, William R. Drobyski, Bryon D
Azelnidipine suppresses the progression of aortic aneurysm in wild mice model through anti-inflammatory effects  Hirotsugu Kurobe, MD, PhD, Yuki Matsuoka,
Regulation of endothelial thrombomodulin expression by inflammatory cytokines is mediated by activation of nuclear factor-kappa B by Richard H. Sohn, Clayton.
Volume 133, Issue 6, Pages (December 2007)
Volume 41, Issue 4, Pages (October 2004)
The Fifth Epidermal Growth Factor–like Region of Thrombomodulin Alleviates Murine Graft-versus-Host Disease in a G-Protein Coupled Receptor 15 Dependent.
Ex vivo effects of proNGF and NGF on JIA mononuclear cells.
NF-κB suppresses the expression of ATP-binding cassette transporter A1/G1 by regulating SREBP-2 and miR-33a in mice  Guo-Jun Zhao, Shi-Lin Tang, Yun-Cheng.
Figure 2 Systemic immune responses to cryptococcal antigen
Volume 82, Issue 6, Pages (September 2012)
Volume 43, Issue 6, Pages (December 2015)
Preeclampsia is associated with a deficiency of lipoxin A4, an endogenous anti- inflammatory mediator  Zhangye Xu, M.D., Feng Zhao, M.M., Feng Lin, M.M.,
IL-36γ Is Involved in Psoriasis and Allergic Contact Dermatitis
Volume 133, Issue 5, Pages (November 2007)
The Protective Effects of Melittin on Propionibacterium acnes–Induced Inflammatory Responses In Vitro and In Vivo  Woo-Ram Lee, Kyung-Hyun Kim, Hyun-Jin.
Transcription of the activating receptor NKG2D in natural killer cells is regulated by STAT3 tyrosine phosphorylation by Shiguo Zhu, Prasad V. Phatarpekar,
Volume 131, Issue 4, Pages (October 2006)
Volume 133, Issue 6, Pages (December 2007)
Volume 143, Issue 5, Pages e4 (November 2012)
Volume 72, Issue 10, Pages (November 2007)
Endothelial cells suppress monocyte activation through secretion of extracellular vesicles containing antiinflammatory microRNAs by Makon-Sébastien Njock,
Expression of 11β-hydroxysteroid dehydrogenase 1 and 2 in patients with chronic rhinosinusitis and their possible contribution to local glucocorticoid.
Dysregulation of LDL receptor under the influence of inflammatory cytokines: A new pathway for foam cell formation1  Dr Xiong Z. Ruan, Zac Varghese, Stephen.
Α7 Nicotinic acetylcholine receptor agonist GTS-21 attenuates ventilator-induced tumour necrosis factor-α production and lung injury  M. Kox, J.C. Pompe,
Volume 34, Issue 5, Pages (May 2011)
Volume 36, Issue 1, Pages (January 2012)
Culture medium from TNF-α–stimulated mesenchymal stem cells attenuates allergic conjunctivitis through multiple antiallergic mechanisms  Wenru Su, MD,
A novel NF-κB inhibitor, dehydroxymethylepoxyquinomicin, ameliorates inflammatory colonic injury in mice  Tohru Funakoshi, Kenichiro Yamashita, Nobuki.
Regulation of IL-33 Expression by IFN-γ and Tumor Necrosis Factor-α in Normal Human Epidermal Keratinocytes  Jitlada Meephansan, Hidetoshi Tsuda, Mayumi.
Duration of Glucocorticoid Treatment and Outcome in Sepsis
Volume 19, Issue 13, Pages (June 2017)
Stuart J. Mills, Jason J. Ashworth, Stephen C. Gilliver, Matthew J
The Role of Mitogen-Activated Protein Kinase-Activated Protein Kinase 2 in the p38/TNF-α Pathway of Systemic and Cutaneous Inflammation  Arndt J. Schottelius,
WNT ligands contribute to the immune response during septic shock and amplify endotoxemia-driven inflammation in mice by Marcela Gatica-Andrades, Dimitrios.
Supplementary Figure 1. Structure of amlexanox
Inter-Regulation of Th17 Cytokines and the IL-36 Cytokines In Vitro and In Vivo: Implications in Psoriasis Pathogenesis  Yijun Carrier, Hak-Ling Ma, Hilda.
Stephen E. Gould, Maria Day, Simon S. Jones, Haimanti Dorai 
Volume 32, Issue 4, Pages (April 2010)
Volume 24, Issue 3, Pages (March 2006)
Figure 1. The activity of CD26/DPP4 in patient samples with lung adenocarcinoma. The measured activity is presented by ... Figure 1. The activity of CD26/DPP4.
Volume 15, Issue 3, Pages (April 2016)
Cathepsin G deficiency reduces periaortic calcium chloride injury-induced abdominal aortic aneurysms in mice  Jing Wang, MD, PhD, Galina K. Sukhova, PhD,
Stroke induces inflammatory activation of the aortic endothelium
Fig. 4. Local application of FR provides prolonged protection against Gq-dependent airway constriction in normal and OVA-sensitized mice in vivo. Local.
Sibylle von Vietinghoff, Hui Ouyang, Klaus Ley  Kidney International 
Blazej Zbytek, Andrzej T. Slominski 
Figure 1 Effect of Ang II treatment for 4 weeks on aortic IL-12p35 expression. (A) IL-12p35 levels were measured in ... Figure 1 Effect of Ang II treatment.
Fig. 1. IL-31 and IL-31R mRNA expression was upregulated in the asthma mouse model. IL-31 and IL-31R mRNA expression was upregulated in the asthma mouse.
Volume 70, Issue 8, Pages (October 2006)
Toll-Like Receptor Activation during Cutaneous Allergen Sensitization Blocks Development of Asthma through IFN-Gamma-Dependent Mechanisms  Rita Haapakoski,
Volume 61, Issue 2, Pages (February 2002)
Acute nephrotoxic and obstructive injury primes the kidney to endotoxin-driven cytokine/chemokine production  R.A. Zager, A.C.M. Johnson, S.Y. Hanson,
CD14 Controls the LPS-Induced Endocytosis of Toll-like Receptor 4
Nicotinamide Mononucleotide, a Key NAD+ Intermediate, Treats the Pathophysiology of Diet- and Age-Induced Diabetes in Mice  Jun Yoshino, Kathryn F. Mills,
Cytokines and cytokine receptors involved in type I immunity in tuberculosis. Cytokines and cytokine receptors involved in type I immunity in tuberculosis.
Volume 15, Issue 2, Pages (February 2007)
**** *** * **** **** *** Shahriary et al.- Supplementary Figure 4 (a)
Presentation transcript:

Table E1 – Sequences of primers used in qPCR experiments Forward Reverse Human Mineralocorticoid receptor (NR3C2) GAGGCTTCAGGATGCCATTA TCTGCAAGCAGGACAATTCTT Glucocorticoid receptor (NR3C1) AGAAAACTCCAGCCAGAACTG GATTTCAGCTAACATCTCGGGGA 18S GGACACGGACAGGATTGACA ACCCACGGAATCCAGAAAGA Alpha 1 D adrenoceptor TCTGCTGGTTCCCTTTCTTC CACGCAGCTGTTGAAGTAGC Mouse Mineralocortcoid receptor (NR3C2) CCAGAAGAGGGGACCACATA GGAATTGTCGTAGCCTGCAT TTCGCAGGCCGCTCAGTGTT TTGGGAGGTGGTCCCGTTGCT α1-a adrenoceptor GCGGTGGACGTCTTATGCT TCACACCAATGTATCGGTCGA α1-b adrenoceptor CCT GGTCATGTACTGCCG GACTCCCGCCTCCAGATTC α1-d adrenoceptor AGTTGGTGACCGTCTGCAAGT CGCTGTGGTGGGAACCGGCAG Endothelin 1 receptor A CCCAAACCTCCCAAGTCTCTC TGGAAATGACATGGGCGGTAT Angiotensin II Receptor type 1 GACTGGATGATGCTGTCTGGC CTTGGAGGGTTGCTGTGAGT CGCCGCTAGAGGTGAAATTC TCTTGGCAAATGCTTTCGC Table E1 – Sequences of primers used in qPCR experiments

  Control LPS LPS-Aldosterone p SBP EC50 (mg/kg) 0.020±10-3 0.019±10-3 0.022±1.2x10-3 ns Emax (mmHg) 38.15±2.1 31.03±2.5 33.23±2.6 DBP 0.016±10-3 0.009±10-3 0.013±10-3 38.97±1.9 28.63±2.7 30.29±2 0.037* Table E2 – Effect of Aldosterone on Blood Pressure response to Phenylephrine in Endotoxic Shock. Systolic and Diastolic response to increasing doses of phenylephrine. Results are expressed as mean±SD *Multiple comparison test: p ≤ 0.05 in all cases

  Control LPS LPS-Aldosterone p EC50 (Log M) 5.1 10-7±5 10-9 5.7 10-7±6 10-9 4.4 10-7±5 10-9 0.03# Emax 1 1±0.2 0.55±0.1 0.78±0.3 0.002## Table E3 – Effect of Aldosterone on ex vivo first-order mesenteric artery contractile response to phenylephrine in endotoxemic mice Dose-response curve parameters. Results are expressed as mean±SD. Vessels were studied 18 hours after LPS (15 mg/kg) and Aldosterone (A mg/kg) injection. n = 1 Normalized on control #Multiple comparison test: p<0.05 for LPS vs Control, and LPS-Aldosterone vs LPS ## Multiple comparison test p<0.05 in all cases

Table E4 – Brief patient and control subject characteristics   Age Gender SAPSII Medical history Medications Site of infection Microorganism Outcome Patient 1 77 M 56 Rectal adenocarcinoma None Soft tissue Escherischia coli Discharged Patient 2 69 42 Aortic valve replacement warfarin Abdomen (pancreatitis) NA Dead in ICU Patient 3 55 50 Myasthenia gravis, thymoma Prednisone, azathioprine, neostigmine Lung Patient 4 44 F 35 Seizures levetiracetam Patient 5 45 Abdomen E. coli and E. faecalis Patient 6 58 COPD Salbutamol, ipratropium Str. Peunomniae Patient 7 32 Chronic sinusitis, ethanol abuse CNS (meningitis) Str. Pneumoniae Control 1 66 - Control 2 Control 3 Control 4 40 Control 5 38 Asthma in infancy Control 6 29 Appendicectomy Levonorgestrel Control 7 59 Table E4 – Brief patient and control subject characteristics

Figure E1 – Effect of Aldosterone on vasoconstrictor receptor expression in endotoxemic mouse aortas. MR and GR mRNA expression in mouse aortas 18 hours after LPS or LPS-Aldosterone injection. Mice were injected intraperitoneally with LPS (15 mg/kg) and Aldosterone (1mg/kg) (n=5 mice per group, * p ≤ 0.05 vs Control, #p ≤vs LPS)

Figure E2 – MR and GR expression in endotoxemic mice aortas Figure E2 – MR and GR expression in endotoxemic mice aortas. MR and GR mRNA expression in mouse aortas 6 hours after LPS or LPS-Aldosterone injection. Mice were injected intraperitoneally with LPS (15 mg/kg) and Aldosterone (1mg/kg) (n=5 mice per group, * p ≤ 0.05 vs Control, #p ≤vs LPS)

Figure E3 – MR expression in HUVECs treated with LPS Figure E3 – MR expression in HUVECs treated with LPS. MR mRNA expression in HUVECs 5, 10 and 24 hours after incubation with LPS (n=5 replicates per group)

* Figure E4 –MR and GR mRNA expression in HUVECs treated with pro-inflammatory cytokines. Cells were incubated with TNF-α (100 ng/ml), IL1-β (50 ng/ml) and IFN-γ (500UI/ml) during 5 hours. (n=6 replicates per condition,* p≤0.05 vs Control)

Figure E5 – Time-course and dose-response of MR expression downregulation by TNF-alpha in HUVECs. Panel A - MR mRNA expression in HUVECs 75 to 450 min after incubation with TNF-α (100 ng/ml). Panel B – MR mRNA expression in HUVECs 5 hours after incubation with TNF-α (0.01 to 100 ng/ml) (n=5 replicates per condition, * p≤0.05 vs control) *

ns Figure E6 - GR mRNA expression in HUVECs treated with TNF-α and BAY 11-7082. GR mRNA expression five hours after treatment with TNF-alpha (10 ng/ml) . (n=6 replicates in all groups)

Figure E7 – Effect of NF-kappa B inhibitor BAY 11-7082 on MR mRNA expression down regulation by plasma from septic patients Cells were pre-incubated with BAY 11-7082 (10 µM) and incubated with septic/control plasma for 5 hours (n= 3 subjects per group, 3 replicates per condition, *p≤0.05 vs Control, #p≤0.05 vs patients)