1. A B pre neg. pre-miR-92apre neg.pre-miR-92a n.s. SMC apoptosis (OD 450 nm) EC apoptosis (OD 450 nm) n.s. Figure S1: pre-miR-92a does not influence vascular cell apoptosis in vitro. (A+B) EC and SMC were treated with pre-miR-92a or a pre-miR control (pre neg.; 20nM), and apoptosis was assessed using a TUNEL based ELISA (n=4; P=n.s.) Figure S1

2. * * Figure S2. Downregulation of Itga5, Sirt1 and eNOS by pre-miR-92a. Transfection of EC with pre-miR-92a induced a significant down-regulation of Itga5, Sirt1 or eNOS mRNA levels 24 hours post transfection, as determined by pPCR. * Figure S2

3. * * * C Integrin α5 DAPI D Figure S3. Systemic application of LNA-92a leads to down-regulation of miR-92a. (A- C) LNA-92a or an unspecific LNA-control (LNA-Co) were injected into the tail vein of mice at 5mg (A+B) or the indicated concentrations (C), and the expression of miR-92a was determined in the Aorta, the lung or the heart at 7 days after injection. (D) At 14 days after vascular injury, immunohistochemical analysis indicates an increased expression of Itga5 and Sirt1 following treatment with LNA-92a compared to controls. The arrow indicates the luminal side of the neointimal lesion which is partially covered by endothelial cells expressing Sirt1. LNA-ControlLNA-92a SIRT1 DAPI 50µm Figure S3 AortaLung * * miR-92a expression (normalised to sno202) miR-92a expression (normalised to sno202) Heart B A

4. Cre + miR-92a fl/fl fl-Genotyping Cre-Genotyping PrimerPrimersequence (5‘-3‘)LengthUsage Cre 1084GCGGTCTGGCAGTAAAAACTATC 100 bp genotyping of the Cre- recombinase Cre 1085GTGAAACAGCATTGCTGTCACTT IL-2 42CTAGGCCACAGAATTGAAAGATCT 324 bp internal control for genotyping of the Cre- recombinase IL-2 43GTAGGTGGAAATTCTAGCATCATCC 28614flp-DIM1AATGTGTGTCTTAGAGGCCTAGTAGTGAAGAGG fl allele: 362 bp WT allele: 247 bp genotyping of the miR-92a flox mice 28615flp-DIM1CACCCCCATTCCTGAAAGCTTATAGC fl allele (362 bp) WT allele (247 bp) 400 bp 300 bp 200 bp 100 bp miR-92a fl/+ 300 bp 200 bp 100 bp IL-2 (internal control) (324 bp) Cre (100 bp) Cre - Figure S4: Genotyping of Tie2-Cre;miR-92a(fl/fl) mice. (A, B) Genotypes of miR-92a(fl/+) mice and miR-92a(fl/fl) mice with or without Cre recombinase expression were confirmed by PCR and gel-electrophoresis. IL-2 was used as an internal control. (C) Primers used for genotyping are indicated above. A C B Figure S4

5. * Figure S5: miR-92a and miR-17~92a cluster expression in conditional miR-92a KO mice. (A) In total heart tissue, miR-92a expression was slightly reduced as confirmed by qPCR (n=10, *P<0.05) (B) miR-92a expression was abolished in sorted vascular endothelial (VE)-cadherin positive lung EC (n=6, *P<0.05). (C) The expression of the other cluster members miR-17, miR-18a, miR-19a, miR-20a, and miR-19b was not affected within VE cadherin positive lung EC (n=6, P=n.s.). * A C B Figure S5

6. Figure S6 Figure S6. Overview on the miR-92a-expression following vascular injury. (A) In quiescent vessels, miR-92a is predominantly expressed in EC. (B) During re- endothelialization following vascular injury, miR-92a is highly expressed in activated EC adjacent to the injury and EC that repopulate the injury site during the healing process, thus limiting the regenerative capacity of EC. (C) LNA-based knock down of miR-92a enhances the regenerative capacity of EC, accelerates re-endothelialization of the injured area and thus limits the inflammatory response and subsequent SMC proliferation and vessel narrowing.

7. salineLNA-controlLNA-92aP value Leukocytes (10 9 /L) 4.2±1.14.3±0.73.9±1.1 n.s. Platelets (10 9 /L) 440±225588±88344±97 n.s. Segmented Neutrophils (10 9 /L) 0.59±0.230.48±0.090.32±0.11 n.s. Monocytes (10 9 /L) 0.13±0.210.13±0.060.14±0.14 n.s. Lymphocytes (10 9 /L) 3.53±0.733.67±0.593.51±1.01 n.s. Erythrocytes (10 12 /L) 9.38±0.809.48±0.249.82±0.41 n.s. Hemoglobine (g/L) 139±9.4140±3.8145±7.6 n.s. Lactate dehydrogenase (U/L) 594±163665±138589±151 n.s. Cholesterol (mmol/L) 2.33±0.541.97±0.051.79±0.16 n.s. Creatinine (µmol/L) 8.8±0 n.s. Aspartate transaminase (U/L) 163±101135±68119±48 n.s. Alanine transaminase (U/L) 35±1528±434±5 n.s. Albumin (g/L)22±323±120±3n.s. Table S1: Analysis of peripheral blood after injection of LNA-92a, LNA-control, or saline. Blood samples were collected at 14 days after injury in mice treated with LNA-92a, control LNA, or saline (n=6). The analysis was performed by the department of clinical chemistry at the Justus-Liebig-University, Giessen, based on a biochemical panel and a full blood count. Table S1