1. GeneEnsembl Gene IDPrimer sequenceAmplicon size(BP) DDAH1ENSMUSG00000028194 Forward (5'to 3') CCCAGCAAAGGGCATGTC Reverse (5' to 3') CCATCTCCGAGTTGCTCACA 124 DDAH2ENSMUSG00000007039 Forward (5'to 3') CCTGGTGCCACACCTTTCC Reverse (5' to 3') AGGGTGACATCAGAGAGCTTCTG 88 Alpha Tubulin 2ENSMUST00000077577Forward (5'to 3') GCCTTCTAACCCGTTGCTATCA Reverse (5' to 3') CGGTGCGAACTTCATCGAT 264 Supplementary Table S1. Primer sequences used for PCR amplification of DDAH1, DDAH2 and tubulin message

2. s1As1B s1C Supplementary Figures s1D Supplementary Figure S1. Conscious cardiovascular hemodynamics and activity during 24 hour period (shaded area represents 12 hour dark cycle) in naive DDAH1 +/- (white squares) and DDAH1 +/+ (black triangles). A) systolic blood pressure; p=ns B) Diastolic blood pressure; p=ns C) heart rate; p=ns D) pulse pressure; p=ns.

3. 1E * Supplementary Figure S1e Conscious cardiovascular hemodynamics and activity during 24 hour period (shaded area represents 12 hour dark cycle) in naive DDAH1 +/- (white squares) and DDAH1 +/+ (black triangles). E) Activity *p<0.05 Two Way ANOVA as indicated. n≥ 6.

4. 140 120 100 80 60 Mean arterial blood pressure (mmHg) 051015 Time (mins) post challenge Vasopressor challenge S1f Representative superimposed blood pressure traces from DDAH1 +/- (red) and DDAH1 +/+ (blue) anaesthetised mice after 24 hours LPS treatment and subsequent vasopressor (phenylephrine) challenge as indicated with arrow. DDAH1+/- mice show an enhanced and more prolonged responsiveness to vasopressor challenge compared to DDAH1 +/+ mice where blood pressure decays to baseline within 12-13 minutes

5. S2 Alignment of human DDAH1 and DDAH2 amino acid sequences. Red boxes indicate highly conserved region close to L-257 binding pocket. Highlighted residues indicate single residue difference between the two proteins: Glycine 129 (G129) in DDAH1 which is a threonine equivalent in DDAH2.

6. * Figure S3 Cytokine profile in primary hepatocytes obtained from DDAH1 +/+ (black bars) and DDAH1 -/- (grey bars) mice or from WT mice treated ex vivo with L-257 100  M A) IFN gamma; B) IL1 beta C) IL-6 D) TNF alpha. n=6 *p<0.05 One Way ANOVA vs. DDAH1 +/+ as indicated. s3As3B s3Cs3D