Neuroendocrine Tumour Biobank Dr Chrissie Thirlwell Cancer Research UK Clinician Scientist Senior Lecturer Medical Oncology Royal Free Hospital NET Unit and UCL Cancer Institute Open Access UCL 18 th April 2013

European Centre of Excellence new cases/month >1500 cases under follow up NET Biobank Royal Free Academic NET Unit

RARE BUT high prevalence –0.5% malignancies 5/ UK popn Sites –GI tract 62-67% –Lung 22-27% Survival –5yr OS 93% local disease, 74% regional, 19% metastatic disease –12-22% cases present with metastases Neuroendocrine Tumours

Yao, J. C. et al. J Clin Oncol; 26: NET incidence rising

NET patient Hepatobiliary & GI surgery Radiology & Nuclear Medicine Oncology Pathology Gastroenterology Endocrinology Cardiology Genetics Dieticians Palliative care Specialist NET Nurses

Research Objectives Integrated genomic analysis of PNETs PNET DNA meth CNV Exome seq RNA exp cfDNA CTC

CGTTACGATGGACGGTATGCTCCGTAAG GENE OF INTEREST DNA SEQUENCE DNA METHYLATION RNA EXPRESSION COPY NUMBER ANALYSIS Integrated genomic PNET analysis

Why set up a NET biobank? Garbage in…… Diamonds in……

Governance Infrastructure Human Tissue Authority licence – prospective research tissue bank – framework and guidelines – allows satellite sites Research Ethics Committee approval R & D approval in each participating Trust

Management Infrastructure Policies and Procedures – Quality management system – Risk register – Disaster recovery plan – Incident log

Management Infrastructure Standard Operating Procedures – Collection – Storage – Processing – Equipment Robust tracking system Sample and data audits

What to collect?

Specialised samples Blood (circulating tumour cells, DNA, RNA, miRNA) Metastatic biopsies Cells from ascites/pleural effusions Carcinoid heart valves

Quality Assurance – FF tissue Sections are cut from frozen tissue and stained with haematoxylin and eosin Percentage tumour is assessed for each tumour block

Data entry and storage All samples are labelled with a 2D barcode label and scanned directly into the database to avoid transcription errors Each sample has an anonymised unique identifier Samples are then stored appropriately in the -80 o C freezer

NET Biobank Funding –Raymond and Beverly Sackler Foundation Prospectively consent and collect tissue / biological samples Robust infrastructure, HTA compliant

Benefits of banking within UCL/RFH Biobank Infrastructure Staff Resources Cheaper than going it alone Improves funding opportunities

NET BioBank Jan 2013 holdings Subjects218 Sampling events2678 Fresh tissue107 Serum1264 Plasma1280 Cell pellets99

Clinical Database Full time Clinical Data Manager Bespoke secure web accessed database –Interface with Cerner ~1000 patients entered Improve efficiency and quality of clinical audit and research

Key findings Integrated genomic analysis of PNETs PNET DNA meth CNV Exome seq RNA exp cfDNA CTC Novel DNAm biomarkers Wnt signalling DNAm enhancer regions Novel DNAm biomarkers Wnt signalling DNAm enhancer regions Reassignment of Ki-67 grading ARID1A mutation Supports DNAm findings

Summary =

Acknowledgements Royal Free NET Unit Tim Meyer Martyn Caplin Brian Davidson UCL Cancer Institute - Medical Genomics Stephan Beck Marianne Eymard Harpreet Dibra Laura Schulz Anna Karpathakis Serif Sasmaz Andy FeberUCL-RFH Biobank Lee Butcher Chris Bell UCL Genome Centre Kerra Pearce Mike Hubank Funding Cancer Research UK Raymond and Beverly Sackler Foundation Wellcome Trust / Academy of Medical Sciences contact: